BIO 235 - Final Exam 2022 quetions and answer All correct
3 views 0 purchase
Course
BIO 235
Institution
BIO 235
BIO 235 - Final Exam Study Guide
The Central Dogma of molecular biology states that, in cells, biological information _______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only...
the central dogma of molecular biology states that
Written for
BIO 235
All documents for this subject (228)
Seller
Follow
Classroom
Reviews received
Content preview
BIO 235 - Final Exam Study Guide
The Central Dogma of molecular biology states that, in cells, biological information _______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses Ans: B
What is the exception to the Central Dogma rule? Ans: RETROVIRUSES (process goes from RNA to DNA
using reverse transcriptase enzymes)
What do retroviruses have that allows them to go from RNA to DNA? Ans: Reverse transcriptase
enzymes
What category of transposable elements use an RNA copy of their genome in the process of
transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids Ans: D
Copy-and-paste transposons a.k.a. replicative transposition Ans: A new copy of the transposable
element is introduced at a new site while the old copy remains behind at the original site (so the
number of copies of the transposable element increases)
Transposons a.k.a. transposable elements Ans: Sequences that can move about in the genome and are
often a cause of mutations
Are direct repeats part of a transposon? Ans: NO
Are inverted repeats part of a transposon? Ans: YES
Transposition Ans: The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition Ans: Transposable element excises from
the old site and inserts at a new site WITHOUT any increase in the number of its copies
Retrotransposons Ans: Elements that transpose through an RNA intermediate
,Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules are called
________, whereas mutagenic compounds that cause the covalent attachment of a methyl or an ethyl
group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents Ans: C
Base analogs Ans: Chemicals with structures similar to that of any of the four standard bases of DNA
(DNA polymerase canNOT distinguish these analogs from the standard bases)
Alkylating agents Ans: Chemicals that donate alkyl groups like methyl and ethyl groups
Deamination Ans: Removing an amino group
Intercalating agents Ans: Produce mutations by sandwiching themselves (intercalating) between
adjacent bases in DNA, distorting the three-dimensional structure of the helix and causing single-
nucleotide insertions and deletions in replication
What form of radiation causes double-strand breaks in DNA? Ans: X-rays (ionizing radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? Ans: UV rays
Pyrimidine dimers Ans: Formation of a chemical bond between adjacent pyrimidine molecules on the
same strand of DNA
Depurination Ans: The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 Ans: D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the formation of alpha-
helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in space Ans: C
, Primary structure of a protein Ans: Sequence of amino acids
Secondary structure of a protein Ans: Interactions between neighboring amino acids causing a
polypeptide chain to fold and twist (alpha helix and beta pleated sheet - regional folding)
Tertiary structure of a protein Ans: Overall-three dimensional shape of the protein (when secondary
structures fold even further)
Quaternary structure Ans: When two or more polypeptide chains associate
When codons that specify the same amino acid differ in ________, a single tRNA may be able to anneal
to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide Ans: E (wobble takes place on the THIRD position of a codon and the FIRST
position of the anticodon)
Where does wobble take place on the codon? (5' end or 3' end?) Ans: 3' end (third position)
Where does wobble take place on the anticodon? (5' end or 3' end?) Ans: 5' end (first position)
Through wobble, a single __________ can pair wit more than one __________.
A. codon; anticodon
B. group of three nucleotides in DNA; codon in mRNA
C. tRNA; amino acid
D. Anticodon; codon Ans: D
The increase in number (expansion) of three-nucleotide repeats is responsible for?
A. Sickle-cell anemia
B. Xeroderma pigmentosum
C. Alkaptonuria
D. Trisomy 21
E. Fragile X syndrome
F. None of the above Ans: E
How many copies of the CGG repeat does a normal/unaffected person? (fragile X syndrome) Ans: Less
than 55 (60)
How many copies of the CGG repeat does a premutated individual have? (fragile X syndrome) Ans: 55-
230
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller Classroom. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $12.99. You're not tied to anything after your purchase.