Exam (elaborations)
Plan van aanpak MBO
- Course
- Institution
Plan van aanpak voor het onderzoeksvak MBO. Er is een 10 behaald voor dit verslag.
[Show more]
Seller
Follow
isabeldevette
Content preview
Moleculaire Biologie OnderzoekenPlan van Aanpak
Naam: Isabel de Vette
Studentnummer: 1141845
Klas: BM2O
Vak: MBO (Moleculaire Biologie Onderzoeken)
Docent: Boet van Riel
Sequenties: plasmide 1 + sequentie O
1
,Inhoudsopgave
1. Voorbereiding.....................................................................................................................................3
1.1 Identificatie juiste mRNA/eiwit vanuit gegeven RNA-sequentie...................................................3
2. Kloneringsstrategie 2.1 CDS, uitgagspunt primerontwerp..................................................................4
2.2 Onderdelen van de gegeven plasmide..........................................................................................4
2.3 Primers deel I: CDS-specifieke primers.........................................................................................5
2.4 Primers deel II: restrictiesites aan de primers...............................................................................7
2.5 Aanpassing voor in frame kloneren..............................................................................................8
2.6 Vectorkaartje (plasmide+insert) en gehele sequentie................................................................10
3. Uitvoering.........................................................................................................................................11
3.1 PCR programma..........................................................................................................................11
3.2 Herkomst PCR template..............................................................................................................12
4. Validatie............................................................................................................................................13
4.1 Voorstel voor plasmide controle op DNA-niveau........................................................................13
4.1.1 Contole met behulp van primers.........................................................................................13
4.1.2 Controle met behulp van restricite-enzymen......................................................................14
4.3 Suggestie voor methode om fusie-eiwit op te zuiveren.............................................................17
Bijlage 1: mRNA/cDNA sequentie van Cyclin A2...................................................................................18
Bijlage 2: volledige sequentie van plasmide met insert........................................................................20
Referentielijst.......................................................................................................................................23
2
, 1. Voorbereiding
1.1 Identificatie juiste mRNA/eiwit vanuit gegeven RNA-sequentie
Gegeven sequentie:
CAGACCTACCTCAAAGCACCACAGCATGCACAACAGTCAATAAGAGAAAAGTACAAAAATTCAAAGTATCATG
GTGTTTCTCTCCTCAACCCACCAGAGA
Aan de hand van de gegeven sequentie kan worden bepaald om welk gen van interesse het gaat. Dit
gen van interesse gaan we later in een plasmide zetten. In het programma BLAST kan de sequentie
worden ingevoerd, deze geeft verschillende eiwitten als uitkomst. Om te filteren welke het meest
overeen komt met de gegeven sequentie wordt bij ‘Percent Identity’ 100 to 100 ingesteld. Ook kan
bij ‘Organism’ Homo Sapiens worden ingevoerd, zo worden de resultaten van eiwitten uit eventuele
andere organismen niet weergegeven. De resultaten van BLAST na de gekozen filters zijn in
Afbeelding 1 weergeven.1
Afbeelding 1: resultaten na zoekopdracht BLAST
Voor de identificatie van het juiste eiwit is er een NM-nummer nodig, deze geeft het meest
betrouwbare resultaat. Dit is te zien bij het eerste resultaat uit Afbeelding 1 onder ‘Accesion’. In dit
geval heeft er maar 1 eiwit een NM-nummer, hier wordt voor gekozen. Homo sapiens Cyclin A2 is dus
het juiste eiwit wat bij de gegeven sequentie hoort. Hierbij hoort NM-nummer NM_001237 en het
gaat hier om gen CCNA2, dit is dus het gen van interesse.
3
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller isabeldevette. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $14.20. You're not tied to anything after your purchase.
Can Stuvia be trusted?
4.6 stars on Google & Trustpilot (+1000 reviews)
79789 documents were sold in the last 30 days
Founded in 2010, the go-to place to buy study notes for 14 years now