BCHM307 EXAM 2 QUESTIONS WITH COMPLETE SOLUTIONS ALL GRADED A+
7 views 0 purchase
Course
BCHM307
Institution
BCHM307
BCHM307 EXAM 2 QUESTIONS WITH COMPLETE SOLUTIONS ALL GRADED A+
If an mRNA sequence is GAA, what would be the tRNA anticodon, written 5'-3'?
a. UUC
b. CTT
c. CUU
d. TTG
e. It is not possible to tell from the information given - Answer-a. UUC
1. Following is the sequence of the sense or co...
BCHM307 EXAM 2 QUESTIONS WITH
COMPLETE SOLUTIONS ALL
GRADED A+
If an mRNA sequence is GAA, what would be the tRNA anticodon, written 5'-3'?
a. UUC
b. CTT
c. CUU
d. TTG
e. It is not possible to tell from the information given - Answer-a. UUC
1. Following is the sequence of the sense or coding strand of a particular gene. What is
the amino acid sequence of the peptide encoded in this gene? Use the standard genetic
code to aid you in finding an answer.
5'-GCTAGGCATGTACGCCGGTCA-3'
a. Ala-Arg-His-Val-Arg-Arg-Ser
b. Met-Tyr-Ala-Gly-Gln-Leu-Gly
c. Met-Tyr-Tyr-Asn-Phe-His-Arg
d. None of the above - Answer-a. Ala-Arg-His-Val-Arg-Arg-Ser
Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent
causes C to be mutated to T. What is the outcome if this type of mutation occurs in the
bases of codon 5 in the sequence of the following sense strand of DNA? Use the
standard genetic code to aid you in finding an answer.
CGCTCACTAGGTCACACGATC
a. There would be a change in DNA sequence and a change in the protein sequence
b. There would be a missense mutation, resulting in the substitution of an Asn for a His
residue in the protein
c. There would be a nonsense mutation, resulting in the synthesis of a truncated protein
d. Both B and C are possible outcomes - Answer-a. There would be a change in DNA
sequence and a change in the protein sequence
The N-terminus of every newly made polypeptide contains
a. A start codon
b. A short RNA primer
c. A methionine residue
d. A Shine-Dalgarno sequence - Answer-c. A methionine residue
Which of the following statements about the structure of RNA is FALSE?
a. The bases present in RNA are adenine, guanine, uracil, and cytosine
b. RNA molecules often have intricately folded 3-dimensional structures
,c. RNA can form a double helix and form base pairs
d. RNA structural stability is largely determined by hydrogen bonds between bases -
Answer-d. RNA structural stability is largely determined by hydrogen bonds between
bases
Which of the following statements about the genetic code is false?
a. AUG Encodes methionine and is also the start signal for translation
b. Codons in mRNA are "read" by base pairing with anticodons in tRNA
c. Serine is only represented by four codons, UCU, UCC, UCA, and UCG
d. The genetic code is described as degenerate because there are more codons than
amino acids - Answer-c. Serine is only represented by four codons, UCU, UCC, UCA,
and UCG
The CFTR Gene (see problem 4) codes for the cystic fibrosis transmembrane
conductance regulator. This protein functions as a chloride ion transporter in the cell
membrane. What can you conclude about the identity of the first 20 or so amino acids in
the newly synthesized CFTR polypeptide?
a. The first 20 amino acids are hydrophobic, as CFTR is a peripheral membrane protein,
and the N-terminal amino acids must serve as a signal peptide directing transport to the
membrane
b. The first 20 amino acids are hydrophilic, as CFTR is a cytosolic protein
c. The first 20 amino acids are hydrophobic, as CFTR is an integral membrane, and the
N-terminal amino acids must serve as a signal peptide directing transport to the
membrane
d. The identity of the first 20 amino acids has no impact on function of the protein -
Answer-c. The first 20 amino acids are hydrophobic, as CFTR is an integral membrane,
and the N-terminal amino acids must serve as a signal peptide directing transport to the
membrane
At low frequencies during DNA replication, an extra nucleotide may be inserted into the
DNA strand. If this occurs within a gene, what would be the effect on the protein
product?
a. Only one amino acid residue within the protein could possibly be different
b. Protein synthesis would always end at the site corresponding to the nucleotide
insertion
c. The protein product could have multiple amino acid residue changes and could be
smaller or bigger
d. The change in the DNA sequence would have no effect on the protein product -
Answer-c. The protein product could have multiple amino acid residue changes and
could be smaller or bigger
In eukaryotic translation initiation,
a. The promoter sequence interacts with the ribosome
b. The ribosome locates the first AUG codon in the mRNA
c. The 30S and 50S subunits form a 70S ribosome
, d. The ribosome converts the circular mRNA to linear mRNA - Answer-b. The ribosome
locates the first AUG codon in the mRNA
During transpeptidation,
a. The ribosome located the first stop codon
b. The messenger RNA enters the P site of the ribosome
c. The peptidyl group is transferred to the aminoacyl group
d. The ribosome advances by one codon along the mRNA - Answer-c. The peptidyl
group is transferred to the aminoacyl group
The tRNA bearing an amino acid enters the ribosome at the ___ site.
a. P
b. X
c. A
d. E - Answer-c. A
The conformation of a protein is stabilized by all of the following except
a. Ion pairing
b. Hydrogen bonding
c. Phosphodiester linkages
d. The hydrophobic effect - Answer-c. Phosphodiester linkages
Which type of covalent protein modification does not take place post-translationally?
a. Addition of amino acid residues
b. Removal of methionine
c. Phosphorylation
d. Attachment of carbohydrates - Answer-a. Addition of amino acid residues
Which step of protein synthesis does not involve ATP or GTP?
a. Attaching an amino acid to tRNA
b. Delivering an aminoacyl-tRNA to the ribosome
c. Movement of the ribosome from one codon to the next
d. The reaction catalyzed by peptidyl transferase - Answer-d. The reaction catalyzed by
peptidyl transferase
The genetic code is said to be redundant because
a. Some codons act as start and stop signals
b. Some amino acids have more than one codon
c. Several research groups cracked the code simultaneously
d. One codon can have several different meanings - Answer-b. Some amino acids have
more than one codon
What is meant by redundancy in the genetic code?
a. There are many amino acids that can be used during the translation of an mRNA to
form a protein
b. The same genetic code is used for essentially all organisms
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller Perfectscorer. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $13.29. You're not tied to anything after your purchase.
