Exam (elaborations)
HLA CHT PRACTICE EXAM QUESTIONS
- Course
- Institution
HLA CHT PRACTICE EXAM QUESTIONS
[Show more]
Content preview
HLA CHT PRACTICE EXAM QUESTIONSBlood specimens known to carry pathogens are packaged the same as routine
specimens..... true or false - Answers -True
When performing a blood draw, what is not part of the routine procedure?
Change gloves in between patients
Informing patient of HIV status
Wear a lab coat or gown - Answers -Informing patient of HIV status
What is a fire assembly area? - Answers -A safe place to meet during a fire, that is
predetermined by employer
Reagent x arrives in the lab, What action is the best action to do? - Answers -
Periodically QC the reagent and develop a QA analysis of its performance to derive an
appropriate expiration date
Which of the folllowing samples would be least preferred for CDC/PRA testing?
A Plain red top tube
B Serum separator tube
C Frozen serum
D ACD yellow top tube - Answers -D
Thrombin is used for what? - Answers -Clotting anti-coagulated plasma
What treatment causes the chelation of magnesium and calcium? - Answers -EDTA
What is the purpose of pronasing cells for a flow crossmatch? - Answers -To remove
CD20 from the cell surface
What does C1V1=C2V2 mean? - Answers -C1=Concentration of the stock
V1=volume to be removed from the concentrated stock solution
C2=Final concentration of the diluted solution
V2=Final volume of the diluted solution
Dead cells stained with AO/EB appear orange because
a. Ethidium bromide prevents AO binding
b. AO leaks out of the dead cell, leaving only ethidium bromide
c. Ethidium bromide fluoresces much more strongly than AO
d. AO binds only RNA, which washes away when the cell is dead
e. Dead cells are actually orange. - Answers -C
Ficoll separates lymphocytes based on what? - Answers -Density
What effect do heterophile antibodies in the complement have on the AHG-CDC assay?
, A) CDC assay complement does not contain appreciable amounts of heterophile
antibodies
B) Enhances the effectiveness of the complement
C) many false negative reactions
D) Decreased CYNAP effect - Answers -C
What is the usual source of complement used in CDC crossmatch assay? - Answers -
Rabbit
Which of the following is true about storing flourescent reagents including monoclonal
antibodies and micro array beads?
A) Ensure reagent is kept frozen as much as possible, so replace vial in freezer
between runs
B) Ensure reagent is kept in the dark to avoid photobleaching, so use light blocking vials
and store them in a closed box
C) Ensure reagent is not frozen, so leave vials at 4c or on the beach
D) Ensure reagent receives sufficient light to activate fluorescence, so leave vial on the
counter with the lights for at least 1 hour - Answers -B
The usual final concentration of DMSO for freezing cells? - Answers -10 percent
A short DNA oligonucleotide used for PCR-SSP amplification is what?
A) Probe
B) Amplicon
C) Polymerase
D) Primer
E) Okazaki fragment - Answers -Primer
Which of the listed probes with have the highest TM?
A) AACTAGTTA
B) CTATGGATCGTTGGCTACTCT
C) GTAGATTATATTACTCTAGCA
D) AACTAGTTC
E) ATATATATAT - Answers -C...Look for the most G/Cs
Primers and probes bind to their DNA targets through a process known as
a) High stringency
b) Hydrogen bonding
c) Covalent bonding
d) Primer dimerism
e) Low Stringency - Answers -B Hydrogen Bonding
Which is true of the 3' and/or 5' ends of an oligonucleotide primer?
a) The 3' and 5' ends always have purines
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller GEEKA. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $10.99. You're not tied to anything after your purchase.
Can Stuvia be trusted?
4.6 stars on Google & Trustpilot (+1000 reviews)
75632 documents were sold in the last 30 days
Founded in 2010, the go-to place to buy study notes for 14 years now