Exam (elaborations)
MB ASCP CONNECT EXAM
- Course
- Institution
- Book
MB ASCP CONNECT EXAM
[Show more]
Connected book
Book Title:
Author(s):
- Edition:
- ISBN:
- Edition:
Seller
Follow
morrismuriithi009
Content preview
MB ASCP CONNECT EXAM LATEST ACTUAL EXAM 200QUESTIONS AND CORRECT ANSWERS WITH
RATIONALES|ALREADY GRADED A+
What is translocation is associated with Burkitt's Lymphoma?
a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17) - ANSWER: t(8; 14)
TIP: Burkkitt's 8 letters,
Locus PF Child Paternity Index
LOC-A1 3 2/3 2.18
LOC-B2 7/5 5 0.798
LOC-C3 17/17 9/17 5.21
LOC-D4 12 12 1.37
Based on the data presented in the table above and with a prior probability (PP) of
0.5, the probability of paternity in this case is :
a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5% - ANSWER: 92.5 %
Multiply all PI together = CPI
(CPI x PP) / [CPI x P + (1 - PP)
OR ...
CPI / (1 + CPI)
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation - ANSWER: Frame-shift mutation
,Which of the following is not involved in the splicing reaction?
a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site - ANSWER: Hairpin loops
Which of the following statements are characteristics of the melt curve analysis?
(hint: more than one answer)
a. At the melting point, the probe separates from the target strand and fluorescence
rapidly decreases.
b. The melting temperature of double stranded DNA depends on its base
composition and length.
c. All PCR products for a specific primer pair should have the same melting
temperature.
d. When hybridization probes are utilized, the temperature is incrementally
decreased while fluorescence is monitored. - ANSWER: At the melting point, the
probe separates from the target strand and fluorescence rapidly decreases.
The melting temperature of double stranded DNA depends on its base composition
and length.
All PCR products for a specific primer pair should have the same melting
temperature.
In the field of molecular diagnostics, which one of the following genes is responsible
for the synthesis of DNA, promote cell division, and inhibit cell death?
a. Proto-oncogenes
b. Tumor suppressor genes
c. Oncogenes
d. Mitochondrial genes - ANSWER: Proto-oncogenes
Microsatellite instability is best described as:
a. The ability of a gene with repeating elements of 8-10 base pairs to randomly
mutate
b. Contraction or expansion of the genome caused by frameshift mutations
(deletions or insertions) in elements of the genome consisting of a repeating
sequence of 1-3 base pairs
c. Repetitive elements in the genome with the ability to self-prime, thus creating
additional copies of genetic material at the allele loci
d. Random gene rearrangement between repeating elements of the same size on
different chromosomes resulting in different size gene products - ANSWER:
Contraction or expansion of the genome caused by frameshift mutations (deletions
,or insertions) in elements of the genome consisting of a repeating sequence of 1-3
base pairs
Purines and pyrimidines differ from each other in that:
a. Purines are found RNA; pyrimidines are found in DNA
b. There's no difference between purines and pyrimidines
c. Pyrimidines have two rings; purines have one ring
d. Purines have two rings; pyrimidines have one ring - ANSWER: Purines have two
rings; pyrimidines have one ring
TIP: Reciprocals of each other.
Purine, shorter word, longer rings.
Pyrimidine, longer word, shorter ring.
Which of the following molecular methodologies would be the best for detecting a
trinucleotide repeat disorder such as Huntington's disease?
a. Heteroduplex analysis
b. Variable number tandem repeat analysis
c. Single strand conformation polymorphism analysis
d. Reverse-Transcriptase PCR - ANSWER: Variable number tandem repeat analysis
Locus Test C M PF1 PF2
A1 12/15 12 15/17 12/15
B2 13 13/13 13/15 14/15
C3 7/8 8 7 7/7
D4 9/11 9/9 10/11 11
E5 6 6/6 5/7 6
Based on the results above, which one of the two possible fathers is the two-month
old's biological father?
a. Possible Father 1
b. Possible Father 2
c. Neither of the Possible Fathers - ANSWER: Neither
Sickle cell disease is an autosomal genetic disease due to a point mutation in the
beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of
the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many
genetic diseases where a single gene controls the expression of many phenotypic
traits. The phenomenon where a single gene controls the expression of many
phenotypic traits is best referred to as:
a. Pleiotrophy
b. Polygenic inheritance
, c. Epistasis
d. Epigenetics - ANSWER: Pleiotrophy
A technologist uses the spectrophotometer to quantify the amount of DNA extracted
from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to
be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA
extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is:
a. 3540 micrograms
b. 3450 micrograms
c. 3504 micrograms
d. 3054 micrograms - ANSWER: 3054 ug
260 reading x 50 ug/ml (DNA) x dilution factor x resupsension = DNA Yield
260 x 50 x 30 x 0.8 = 3054
When sequencing HLA-DR what is targeted?
a. Exon 1 of the α subunit
b. Exon 2 of the α subunit
c. Exon 1 of the β subunit
d. Exon 2 of the β subunit - ANSWER: Exon 2 of the β subunit
All of the following are components of nucleic acids, EXCEPT:
a. Phosphate group
b. Sugar (ribose or deoxyribose)
c. Nitrogenous base (A, G, C, T)
d. Formamide - ANSWER: Formamide
This polymerase acts on DNA and produces Transfer RNA:
a. RNA Pol II
b. DNA Pol II
c. RNA Pol III
d. DNA Pol III - ANSWER: RNA pol III
In mantle cell lymphoma (MCL), this is the fusion gene created:
a. EWS-FLI1
b. CCND1-IGH
c. BCR-IGH
d. c-myc-EWS - ANSWER: CCND1-IGH
(Cyclin D1)
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller morrismuriithi009. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $17.99. You're not tied to anything after your purchase.
Can Stuvia be trusted?
4.6 stars on Google & Trustpilot (+1000 reviews)
81311 documents were sold in the last 30 days
Founded in 2010, the go-to place to buy study notes for 14 years now