exam 3 genetics 2024/2025 with 100% correct answers
9 views 0 purchase
Course
E3 genetics
Institution
E3 Genetics
Based on what we learned about the most important splicing consensus sequences, what will the sequence of this simplified intron-containing mRNA (written from 5' to 3', left to right) be after splicing occurs? (Don't write anything besides nucleotide letters.)
CAAGGUCCCUCCCACCUAGCAA correct answ...
Based on what we learned about the most important splicing consensus sequences, what will the
sequence of this simplified intron-containing mRNA (written from 5' to 3', left to right) be after splicing
occurs? (Don't write anything besides nucleotide letters.)
Which of the following Before/After statements best describes the change in scientific knowledge
brought about by the Neurospora experiments performed by Beatle & Tatum + Srb & Horowitz?
a) Before: we thought genes and proteins were colinear. After: we know that RNA splicing violates the
principle of colinearity in eukaryotes!
b) Before: we thought protein was the genetic material. After: we know DNA is the genetic material!
c) Before: we thought proteins did all the important work in a cell, while genes played minor roles. After:
we know that proteins are the products of genes!
d) Before: we thought Neurospora were auxotrophic. After: we know that Neurospora are autotrophic!
correct answersc
Imagine you're an astrobiologist trying to crack the genetic code of a microbe in another galaxy. You
isolate a mutant with a one base-pair insertion in Gene X which causes the gene to be frameshifted and
therefore nonfunctional. You then isolate a second base-pair insertion in Gene X a few nucleotides
downstream of the first mutation. When combined, these two mutations result in a functional version of
Gene X. What does this experiment reveal about the genetic code of this alien microbe?
a) The genetic code is quadruplet (words of 4 nucleotides)
b) The genetic code is triplet (words of 3 nucleotides)
c) The genetic code is doublet (words of 2 nucleotides)
d) The genetic code degenerated
e) The genetic code is universal correct answersc
,Which of the following is INCORRECT about SARS-CoV-2 RNA?
a) The - strand serves as the template for translation
Viral RNA is transcribed from an RNA template
b) The + strand is the strand that gets packaged into the virus
c) Both the + strand and the - strand are synthesized by the same enzyme
d) The - strand serves as a template for the + strand, and the + strand serves as a template for the -
strand correct answersa
Which of the following statements about how transposons violate basic laws of genetics is CORRECT.
(You may choose more than one.)
a) Transposons are post-transcriptionally stimulated by piRNAs
b) Some transposons can create additional copies of themselves at new locations in the genome
c) Some transposons can synthesize DNA from an RNA template
d) All transposons require RNA intermediates correct answersb, c
Which of the following statements about ribosomes and ribosomal RNA is NOT true?
a) The human genome has many copies of ribosomal RNA genes
b) Multiple different ribosomal RNAs are processed from a single ribosomal RNA transcript.
c) Ribosomal RNA is typically the most abundant RNA in a cell
d) Ribosomal RNA is typically the most abundant RNA in a cell correct answersd
If a SARS-CoV-2 virus had a loss-of-function mutation in its NSP12 gene (a.k.a. RNA-dependent RNA
polymerase), what would be the most likely outcome for the virus?
a) If a SARS-CoV-2 virus had a loss-of-function mutation in its NSP12 gene (a.k.a. RNA-dependent RNA
polymerase), what would be the most likely outcome for the virus?
b) The virus will be able to transcribe its RNA but unable to replicate its genome
, c) The virus will be able to replicate its genome but unable to translate its structural proteins
d) The virus will have to rely on the RNA polymerase of its eukaryotic host
e) The virus will be able to transcribe its RNA but unable to translate its structural proteins
f) The virus will be unable to replicate its genome or transcribe its RNA correct answersf
The following is a short sequence near the beginning of exon 1 of an mRNA.
5' AUG GCU AAC 3'
What will be the sequence of the anticodon (from 5' to 3', left to right) that will pair with the second
codon in the mRNA?
a) AGC
b) CAU
c) GCT
d) GCU correct answersa
Which of the following RNA molecules serves as an adapter molecule during protein synthesis?
a) tRNA
b) All of the above
c) mRNA
d) rRNA correct answersa
You just isolated a mutant in the eukaryotic single-cell organism Saccharomyces cerevisiae ("Brewer's
Yeast") that fails to transcribe your favorite gene. Which of the following is highly unlikely to contain your
mutation? (You can choose more than one.)
a) Promoter
b) TATA box
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller QUILLSKY. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $17.49. You're not tied to anything after your purchase.
