Which of the following groups of eukaryotic microbes produce antibiotic compounds that we use to
treat bacterial infections?
A. Fungi
B. No eukaryotes naturally produce antibiotics
C. Protists
D. Algae - ✔️✔️Fungi
Which of the following would be the best method for reducing the transmission of endospore-forming
bacterial pathogens in health care settings?
A. Autoclaving all biomedical waste
B. Using 0.2-micrometer syringe filters when administering intravenous fluids
C. Using HEPA filtration
D. UV-C light irradiation of hospital rooms - ✔️✔️Autoclaving all biomedical waste
_____________________________ are constitutive genes. They are always expressed in cells. -
✔️✔️Housekeeping genes
Genes for catabolic pathways are usually _____________ genes. - ✔️✔️inducible
Genes for anabolic pathways are usually ______________ genes. - ✔️✔️repressible
The _____________ is an example of a catabolic pathway. - ✔️✔️lac operon
The _____________ is an example of a anabolic pathway. - ✔️✔️trp operon
, ______________________________ are any proteins with a ______________________, that bind
directly to the DNA double helix and cause changes in the transcription of genes. - ✔️✔️Transcriptional
regulatory proteins, helix-turn-helix motif
_________________________ is when transcription is regulated by the binding of a repressor protein to
the operator region that results in the inhibition of transcription. - ✔️✔️Negative transcriptional control
______________________ is when transcription is regulated by the binding of an activator protein to
the activator binding sites that stimulates transcription. - ✔️✔️Positive transcriptional control
A _____________________________ is a protein that regulates the transcription of multiple different
operons from many different pathways in a cell. - ✔️✔️Global regulatory protein
_____________________________ is a common mechanism for global regulation in cells from all three
domains of life where binding of a molecule to a _________________, a _____________ membrane
protein, that initiates a single cascade through the cell via a ___________________, a
________________ membrane protein, which controls the transcription of many genes. Oftentimes the
signal is carried throughout cells via a _____________________. - ✔️✔️Two component signal
transduction; sensor kinase; integral; response regulators; peripheral; secondary messengers
Examples of secondary messengers include________, which regulates __________________ pathways,
and _______, which regulates pathways that facilitates antibiotic resistance. - ✔️✔️cAMP; catabolite
repression; c-di-GMP
Consider the DNA sequence: TACCAACTACCAATAGTGACT. The sequence of the complementary DNA
strand in a double helix would be______________________. - ✔️✔️ATGGTTGATGGTTATCACTGA
Which class of antibiotics inhibits bacterial cell wall biosynthesis?
A. Tetracyclines
B. Aminoglycosides
C. Penicillins
D. Sulfonamides - ✔️✔️Penicillins
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller VasilyKichigin. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $13.48. You're not tied to anything after your purchase.
