08/23/2023
Emergent property:
- Characteristic an entity gains when it becomes part of a bigger system
- Molecules, organelles, cells, tissues, organs, organisms, population, communities, ecosystems, biosphere
- Different components/properties found within an object/ thing
Valence Electrons
- Amount of electrons within the outer shell of an atom
- Electrons are organized in layers (shells)
- Electrons shells carry electrons which are attracted to the protons in the nucleus
What is the significance of the number of unpaired valence electrons? :
- They are reactive (unstable)
Atomic number:
- Number of protons within the element
- Number of protons and electrons are the same
Bonds:
- Covalent bond: Sharing electrons
- Ionic bond: Attraction between an anion and cation (not sharing electrons/ non-covalent bond)
- Polar covalent bond: One atom is more electronegative
Ions:
- Positive ion = Cation
- Negative ion = Anion
Electronegativity (EN):
- The amount of attraction an element has to electrons of a covalent bond
- Electron transfer: Formation of ions that are attracted to each other
- Huge difference in EN between atoms: Polar covalent bond
- Little difference in EN between atoms:
- No difference in EN between atoms: Non-polar covalent bond
Hydrogen bonding:
- Attracts two water molecules together
- Weak attraction
- Partial negative + partial positive
- Hydrogen
BOXED Q
Biological Hierarchy + Compounds:
- How do the interactions of elements of different levels - (more complex/ less complex) ? (Q)
- Smaller parts combine to make increasingly complex systems (example, Molecules combine to create
organelles, organelles combine to make cells, etc.) (A)
- A: When the pH goes up, the solution becomes more alkaline (meaning there is less hydrogen)
- B: When the pH goes down, the solution becomes more acidic (meaning there is more hydrogen)
08/28/2023
Cohesion: Substance attracted to itself
Adhesion: Substance attracted to another substance
Surface tension:
Emergent properties of water:
- Ability to moderate temperature
- High specific heat which allows it to have evaporative cooling (sweating) (meaning it can absorb lots of
energy before the temperature of the water goes up)
- Universal solvent
, - Many substances can be dissolved in water (water-soluble)
- Ability to freeze:
- The space between molecules is greater in solid form (ice) than in liquid or gas form (expands)
- Temperature buffer
- Cohesive behavior
- Allows for water to act as a column (can go upwards/ downwards)
Kinetic Energy: Energy of motion
Heat: Measure of the total amount of kinetic energy due to molecular motion (molecules are always in movement)
Temperature: Measures the intensity of the heat due to the average kinetic energy of molecules (regardless of
volume)
4 major classes of life’s organic macromolecules:
- Carbohydrates (mono, di, oligo, and polysaccharides)
- Proteins
- Nucleic acids
- Lipids
Dehydration reaction:
- Removes a water molecule, forming a new bond, synthesizing a polymer
Hydrolysis:
- Adding a water molecule to break apart a bond/ polymer
08/30/2023
Carbohydrates:
- Specific kinds of carbohydrates:
- Glucose, fructose, lactose, cellulose, maltose, sucrose, galactose
- Chitin (polysaccharide):
- Structurally similar to cellulose
- Monosaccharides:
- Simple sugars
- Formulas of CH2O
- C = O (carbonyl group)
- How do monosaccharides differ from one another?
- # of carbons,
- Joined by dehydration reaction to make disaccharides and polysaccharides
Lipids:
- Types:
- Fats, steroids, phospholipids
- Fats:
- Glycerol + 3 fatty acids
- Stores energy
- Must be liquid to be functional
- Glycerol:
- Water soluble (hydrophilic)
- Ester linkage:
- Bonds glycerol to fatty acids (3x = triglyceride)
- 2 ways fats differ:
- Chain link (structure)
- Types of bonds
- Saturated fatty acid:
, - No bending
- Room temperature
- Unsaturated fatty acid:
- Bending
- Liquid (at a lower temperature)
- Heat = Energy = Movement
Discussion SGQ:
ATGCCGTCTGACACATGCCCGTAA
TACGGCAGACTGTGTACGGGCATT
AUGCCGUCUGACACAUGCCCGUAA
09/01/2023
Fats:
- Glycerol + 3 fatty acids
- Stores energy
- Must be liquid to be functional
Phospholipids:
- Part polar
- 2 fatty acid chains attached to a glycerol
- Hydrophilic head
- Hydrophobic tail
- Creates a bi-layer when submerged in water:
Protein structure:
- Secondary:
- Alpha-helix and Beta-pleated sheets
09/06/2023 - Protein structures/ levels
- Proteins are polymers made of monomers
- Primary structure: sequence of amino acids covalently bonded with one another
- Alpha helix, beta pleated sheets
- Tertiary structure: bonds between different R groups within a protein help keep it in shape
Denaturation of a protein:
- Heat
- pH
What is the relationship between nucleic acid, a nucleotide, and a dna?
09/08/2023: Origins of Life on Earth
- Evolution:
- Reproduction, Variation, Genetic mutations, etc.
Three domains of life:
- Organisms are divided into 3 main domains:
- Archaea
- Bacteria
- Eukarya:
- Three multicellular kingdoms:
- Plants
- Fungi
- Animals
First single celled organism:
- Stromatolites (fossils formed by the accumulation of prokaryotes)
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller diana25. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $7.99. You're not tied to anything after your purchase.
