100% satisfaction guarantee Immediately available after payment Both online and in PDF No strings attached
logo-home
Previously searched by you
Previously searched by you
logo
MB ASCP exam 2024 with 100% correct answers $14.49
Add to cart
Quickly navigate to
Preview
  2.  
  3. MB ASCP Fh
  4.  
  5. MB ASCP fh

Exam (elaborations)

MB ASCP exam 2024 with 100% correct answers
 0 purchase
  • Course
  • MB ASCP fh
  • Institution
  • MB ASCP Fh

What genes would be screened in a lung cancer panel? correct answersKRAS, EGFR, ALK In a retrovirus, the RNA acts as: correct answersGenome and mRNA To what does the AcrAB gene product create resistance to? correct answersTetracycline What gene is measured following the treatment with imat...

[Show more]

Preview 4 out of 94  pages

Document information

  • August 15, 2024
  • 94
  • 2024/2025
  • Exam (elaborations)
  • Questions & answers

Subjects

Written for

  • MB ASCP fh
  • MB ASCP fh

Seller

avatar-seller
QUILLSKY

Reviews received

Content preview

MB ASCP

What genes would be screened in a lung cancer panel? correct answersKRAS, EGFR, ALK



In a retrovirus, the RNA acts as: correct answersGenome and mRNA



To what does the AcrAB gene product create resistance to? correct answersTetracycline



What gene is measured following the treatment with imatinib(Gleevec)? correct answersBCR/Abl



Blood drawn into what type of tube is compatible for genetic testing? correct answersK2-EDTA tube



Primer dimers are due to what complimentary issue? correct answers3' to 3' complementarity of primer
pairs



Microsatellite instability is best described as: correct answersContraction or expansion of the genomes
caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a
repeating sequence of 1-3 base pairs



How many hydrogen bonds are formed between one C:G base pair? correct answers3



When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes them correct
answersLigase



What assay amplifies the target using DNA ligase? correct answersLCR



What genes would be screened in a breast cancer panel? correct answersHER2, ERBB2, BRCA1



What factors can affect nucleic acid hybridization? correct answersG:C ratio of bases

,pH of the hybridization reaction

Hybridization temperature



Both parents are carriers of an autosomal recessive disorder. What percent chance do these parents
combined have to pass down this affected gene to their child? correct answers75%



Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What
is the melting temperature, Tm, of the sequence? correct answers58*C



The enzyme that primes DNA synthesis is: correct answersDNA primase



Splicing is the process that: correct answersRemoves introns and preserves exons



All of the following enzymes are part of the DNA replication machinery correct answersLigase, DNA
polymerase, Helicase



This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR
gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): correct
answerst(9;22)



Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand?
correct answers5'-ATCTATGTCGGCAATT-3'



All of the following methods of amplification are considered target amplification: correct
answersQuantitative PCR

Strand Displacement Amplification

Reverse Transcriptase PCR



What stain binds to minor groove of DNA Duplex? correct answersSYBR1



The purines are: correct answersAdenine and guanine

,Purines and pyrimidines differ from each other in that: correct answersPurines have two rings;
pyrimidines have one ring



What gene is measured following treatment with Warfarin? correct answersVKORC1



According to Chargaff's rule of base pairing, adenine pairs with: correct answersThymine



When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen as approximately:
correct answersΔCt = 3.3



The process of making RNA is termed: correct answersTranscription



When sequencing HLA-DR what is targeted? correct answersExon 2 of the β subunit



All of the following are components of nucleic acids: correct answersPhosphate group

Sugar (ribose or deoxyribose)

Nitrogenous base (A,C,G,T)



Branched DNA amplification (bDNA) is best classified as: correct answersSignal amplification



This PCR method works by generating a signal at the annealing step (i.e. when the probe binds its target)
of the PCR reaction: correct answersMolecular beacons



What is the predominant form of DNA? correct answersB form



Mantle cell lymphoma (MCL) is caused by what translocation? correct answerst(11;14)



What responds poorly to Ribavarin/Interferon treatment? correct answersHCV type 1 & 4

, The sugar in DNA is: correct answersDeoxyribose



Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular lab? correct
answersTo avoid contamination of specimens with amplified product which create false positive results



Which two HPV types are responsible for most cases of cervical cancer? correct answers16 and 18



The amelogenin locus, found on the sex chromosomes, is used in gender identification. Amplification at
this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this amplification were part of a gender
identification procedure, what would be the gender of the individual? correct answersMale



This restriction enzyme "digests and removes a methyl group from Adenine": correct answersType I



To what does the mecA gene product create resistance to? correct answersPenicillin



3 cerebrospinal fluid (CSF) tubes labeled 1 through 3 have arrived in your clinical laboratory for
evaluation. The tubes were numbered in the order in which they were obtained, with #1 being the first
tube collected and #3 being the last tube collected. What is the best explanation for a macroscopic
appearance seen in the CSF? correct answersA traumatic tap



Next Generation Sequencing set-up require: correct answersLibrary preparation and extensive
bioinformatics analysis



The nitrogenous base in a nucleotide is expected to be found on which position of the sugar? correct
answersC1'



In which of the following methods is the probe digested by the polymerase (Taq) during primer
extension? correct answersTaqman



This polymerase is involved in "initiation of DNA replication and has primase activity": correct
answersPol α

The benefits of buying summaries with Stuvia:

Guaranteed quality through customer reviews

Guaranteed quality through customer reviews

Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.

Quick and easy check-out

Quick and easy check-out

You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.

Focus on what matters

Focus on what matters

Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!

Frequently asked questions

What do I get when I buy this document?

You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.

Satisfaction guarantee: how does it work?

Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.

Who am I buying these notes from?

Stuvia is a marketplace, so you are not buying this document from us, but from seller QUILLSKY. Stuvia facilitates payment to the seller.

Will I be stuck with a subscription?

No, you only buy these notes for $14.49. You're not tied to anything after your purchase.

Can Stuvia be trusted?

4.6 stars on Google & Trustpilot (+1000 reviews)

65040 documents were sold in the last 30 days

Founded in 2010, the go-to place to buy study notes for 15 years now

Start selling

Recently viewed by you

Exam (elaborations) ·

(0)

Leading Marines WARFIGHTING - Spring 2024 (Answered)

Class notes ·

(0)

Weefsels Aantekeningen Hoorcolleges Deel 2

Exam (elaborations) ·

(0)

(CBSPD) Practice Final Exam A+ Solutions 2023

Exam (elaborations) ·

(0)

HFHC Exam 4 Questions and Answers Graded A+

Exam (elaborations) ·

(0)

ENWC201 Exam 1 UD Questions with correct Answers

Summary ·

(0)

Informatik BWL Zusammenfassung by Brockmann Word

Exam (elaborations) ·

(0)

Nurs 201 Neonatal Complications Q&A 2024 Exam

Exam (elaborations) ·

(0)

HESI MENTAL HEALTH RN V1-V3 2023 TEST BANK

Other ·

(0)

NR 446 Week 1 Board Vitals; Question Report
$14.49
  • (0)
Add to cart
Added