What genes would be screened in a lung cancer panel? correct answersKRAS, EGFR, ALK
In a retrovirus, the RNA acts as: correct answersGenome and mRNA
To what does the AcrAB gene product create resistance to? correct answersTetracycline
What gene is measured following the treatment with imat...
What genes would be screened in a lung cancer panel? correct answersKRAS, EGFR, ALK
In a retrovirus, the RNA acts as: correct answersGenome and mRNA
To what does the AcrAB gene product create resistance to? correct answersTetracycline
What gene is measured following the treatment with imatinib(Gleevec)? correct answersBCR/Abl
Blood drawn into what type of tube is compatible for genetic testing? correct answersK2-EDTA tube
Primer dimers are due to what complimentary issue? correct answers3' to 3' complementarity of primer
pairs
Microsatellite instability is best described as: correct answersContraction or expansion of the genomes
caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a
repeating sequence of 1-3 base pairs
How many hydrogen bonds are formed between one C:G base pair? correct answers3
When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes them correct
answersLigase
What assay amplifies the target using DNA ligase? correct answersLCR
What genes would be screened in a breast cancer panel? correct answersHER2, ERBB2, BRCA1
What factors can affect nucleic acid hybridization? correct answersG:C ratio of bases
,pH of the hybridization reaction
Hybridization temperature
Both parents are carriers of an autosomal recessive disorder. What percent chance do these parents
combined have to pass down this affected gene to their child? correct answers75%
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What
is the melting temperature, Tm, of the sequence? correct answers58*C
The enzyme that primes DNA synthesis is: correct answersDNA primase
Splicing is the process that: correct answersRemoves introns and preserves exons
All of the following enzymes are part of the DNA replication machinery correct answersLigase, DNA
polymerase, Helicase
This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR
gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): correct
answerst(9;22)
Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand?
correct answers5'-ATCTATGTCGGCAATT-3'
All of the following methods of amplification are considered target amplification: correct
answersQuantitative PCR
Strand Displacement Amplification
Reverse Transcriptase PCR
What stain binds to minor groove of DNA Duplex? correct answersSYBR1
The purines are: correct answersAdenine and guanine
,Purines and pyrimidines differ from each other in that: correct answersPurines have two rings;
pyrimidines have one ring
What gene is measured following treatment with Warfarin? correct answersVKORC1
According to Chargaff's rule of base pairing, adenine pairs with: correct answersThymine
When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen as approximately:
correct answersΔCt = 3.3
The process of making RNA is termed: correct answersTranscription
When sequencing HLA-DR what is targeted? correct answersExon 2 of the β subunit
All of the following are components of nucleic acids: correct answersPhosphate group
Sugar (ribose or deoxyribose)
Nitrogenous base (A,C,G,T)
Branched DNA amplification (bDNA) is best classified as: correct answersSignal amplification
This PCR method works by generating a signal at the annealing step (i.e. when the probe binds its target)
of the PCR reaction: correct answersMolecular beacons
What is the predominant form of DNA? correct answersB form
Mantle cell lymphoma (MCL) is caused by what translocation? correct answerst(11;14)
What responds poorly to Ribavarin/Interferon treatment? correct answersHCV type 1 & 4
, The sugar in DNA is: correct answersDeoxyribose
Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular lab? correct
answersTo avoid contamination of specimens with amplified product which create false positive results
Which two HPV types are responsible for most cases of cervical cancer? correct answers16 and 18
The amelogenin locus, found on the sex chromosomes, is used in gender identification. Amplification at
this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this amplification were part of a gender
identification procedure, what would be the gender of the individual? correct answersMale
This restriction enzyme "digests and removes a methyl group from Adenine": correct answersType I
To what does the mecA gene product create resistance to? correct answersPenicillin
3 cerebrospinal fluid (CSF) tubes labeled 1 through 3 have arrived in your clinical laboratory for
evaluation. The tubes were numbered in the order in which they were obtained, with #1 being the first
tube collected and #3 being the last tube collected. What is the best explanation for a macroscopic
appearance seen in the CSF? correct answersA traumatic tap
Next Generation Sequencing set-up require: correct answersLibrary preparation and extensive
bioinformatics analysis
The nitrogenous base in a nucleotide is expected to be found on which position of the sugar? correct
answersC1'
In which of the following methods is the probe digested by the polymerase (Taq) during primer
extension? correct answersTaqman
This polymerase is involved in "initiation of DNA replication and has primase activity": correct
answersPol α
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller QUILLSKY. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $14.49. You're not tied to anything after your purchase.
