Exam (elaborations)
MB- ASCP EXAM QUESTIONS AND ANSWERS
- Course
- Institution
MB- ASCP EXAM QUESTIONS AND ANSWERS
[Show more]
Content preview
MB- ASCP EXAM QUESTIONS AND ANSWERSWhat genes would be screened in a lung cancer panel? - Answers -KRAS, EGFR, ALK
In a retrovirus, the RNA acts as: - Answers -Genome and mRNA
To what does the AcrAB gene product create resistance to? - Answers -Tetracycline
What gene is measured following the treatment with imatinib(Gleevec)? - Answers -
BCR/Abl
Blood drawn into what type of tube is compatible for genetic testing? - Answers -K2-
EDTA tube
Next Generation Sequencing set-up require: - Answers -Library preparation and
extensive bioinformatics analysis
The nitrogenous base in a nucleotide is expected to be found on which position of the
sugar? - Answers -C1'
In which of the following methods is the probe digested by the polymerase (Taq) during
primer extension? - Answers -Taqman
This polymerase is involved in "initiation of DNA replication and has primase activity": -
Answers -Pol α
What is the sequence recognized by poly (A) polymerase? - Answers -AAUAAA
In the field of molecular diagnostics, which one of the following genes is responsible for
the synthesis of DNA, promote cell division, and inhibit cell death? - Answers -Proto-
oncogenes
How is warfarin dosage affected in patients with VKORC1 deficiency? - Answers -
Patients receive a lower warfarin dose
This polymerase is involved in "short-patch base excision repair": - Answers -Pol β
What is the best way to store RNA for longer than a month? - Answers -In Ethanol, at -
20°C or -80°C
The rate of DNA migration through an agarose gel during electrophoresis does depend
on which factors? - Answers -Net charge of the molecule
Size of the molecule
Shape of the molecule
,What assay amplifies the target using a combination of a three-enzyme system? -
Answers -NASBA
What is the rate of mammalian DNA replication? - Answers -50 nucleotides per second
According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair
with: - Answers -A or G
In CML, what fusion protein is created? - Answers -BCR-Abl1
This polymerase acts on DNA and produces Ribosomal RNA: - Answers -RNA Pol I
What assay amplifies the probe signal and the probe RNA concentration increases if the
target to be detected is present? - Answers -Qβ replicase
What translocation results in synovial sarcoma, a muscle and fibrous tissue cancer? -
Answers -t(18;X)
The hydroxyl group in a deoxyribonucleotide is expected to be found on which position
of the sugar? - Answers -C3'
If two parents are heterozygous for an autosomal recessive disease, then their offspring
will most likely follow this gene frequency pattern: - Answers -25% homozygous
dominant, 50% heterozygous, and 25% homozygous recessive
As a technologist working in a small clinical laboratory, a nasal swab specimen,
suspected to be colonized by a variety of upper respiratory viruses, came to your
laboratory. You are tasked with determining whether the specimen is colonized with
rhinovirus, coronavirus, and influenza. Which PCR method would best be suitable for
this task? - Answers -Multiplex PCR
What translocation is associated with Burkitt's lymphoma? - Answers -t(8;14)
The 5' capping process creates what type of linkage? - Answers -5'-5'
Choose the right pair of words to complete the following sentence: In hybrid capture
technology, _______ is used to amplify the _______ - Answers -Alkaline phosphatase;
signal
Characteristics of the melt curve analysis: - Answers -At the melting point, the probe
separates from the target strand and fluorescence rapidly decreases
The melting temperature of double stranded DNA depends on its base composition and
length
All PCR products for a specific primer pair should have the same melting temperature
,The process of making RNA is termed: - Answers -Transcription
When sequencing HLA-DR what is targeted? - Answers -Exon 2 of the β subunit
All of the following are components of nucleic acids: - Answers -Phosphate group
Sugar (ribose or deoxyribose)
Nitrogenous base (A,C,G,T)
Branched DNA amplification (bDNA) is best classified as: - Answers -Signal
amplification
This PCR method works by generating a signal at the annealing step (i.e. when the
probe binds its target) of the PCR reaction: - Answers -Molecular beacons
What is the predominant form of DNA? - Answers -B form
Mantle cell lymphoma (MCL) is caused by what translocation? - Answers -t(11;14)
What responds poorly to Ribavarin/Interferon treatment? - Answers -HCV type 1 & 4
The sugar in DNA is: - Answers -Deoxyribose
Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular
lab? - Answers -To avoid contamination of specimens with amplified product which
create false positive results
Which two HPV types are responsible for most cases of cervical cancer? - Answers -16
and 18
The amelogenin locus, found on the sex chromosomes, is used in gender identification.
Amplification at this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this
amplification were part of a gender identification procedure, what would be the gender
of the individual? - Answers -Male
This restriction enzyme "digests and removes a methyl group from Adenine": - Answers
-Type I
To what does the mecA gene product create resistance to? - Answers -Penicillin
3 cerebrospinal fluid (CSF) tubes labeled 1 through 3 have arrived in your clinical
laboratory for evaluation. The tubes were numbered in the order in which they were
obtained, with #1 being the first tube collected and #3 being the last tube collected.
What is the best explanation for a macroscopic appearance seen in the CSF? -
Answers -A traumatic tap
, A patient with impaired judgment, personality changes, signs of abnormal body
movements and depression comes to the physician's office for a follow-up visit. The
physician suspects a single-gene disorder may be the cause of those clinical
manifestations. A blood specimen was then sent to your clinical laboratory for mutation
screening in the Huntingtin gene. Which of these methods would best accomplish this
task? - Answers -Standard PCR
This enzyme is known for "unzipping" genes - Answers -Helicase
In real-time PCR, what is amplified? - Answers -The target
This restriction enzyme "digests and adds a methyl group from Adenine": - Answers -
Type III
T-Cell Gene Rearrangement is seen in what malignancy? - Answers -Non-Hodgkin
Lymphoma
Which of the following storage options is optimal for storing isolated DNA for a period
greater than seven years? - Answers --70ºC
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a: - Answers -Frame-shift mutation
Consider a hypothetical mutation involving gene X. Let's say you amplify a specific
exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person
without the mutation, cutting the gene with restriction enzyme W generates two
fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a
restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person
for gene X to have these fragments on a restriction gel: - Answers -m/+ = 350 bp; 250
bp; 100 bp
What drug is NOT metabolized by CYP2D6? - Answers -Warfarin
What drugs are metabolized by CYP2D6? - Answers -Codeine, Omeprazole, and
Escitalopram
A cerebrospinal fluid (CSF) sample for hematologic evaluation should be tested within
how many hours of collection? - Answers -1 hour
Primer dimers are due to what complimentary issue? - Answers -3' to 3'
complementarity of primer pairs
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller GEEKA. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $14.49. You're not tied to anything after your purchase.
Can Stuvia be trusted?
4.6 stars on Google & Trustpilot (+1000 reviews)
78998 documents were sold in the last 30 days
Founded in 2010, the go-to place to buy study notes for 14 years now