Which of the following is not a component of a nucleotide?
Phosphate group
Anti-codon
Ribose sugar
Nitrogen base - Answers -Anti-codon
According to Chargaff's rule of base pairing, adenine pairs with: - Answers -Thymine
What genes would be screened in a breast cancer panel? - Answers -HER2, ERBB2,
BRCA1
Next Generation Sequencing uses: - Answers -Short sequence reads
Purines and pyrimidines differ from each other in that: - Answers -Purines have two
rings; pyrimidines have one ring
The purines are:
Cytosine and uracil
Adenine and thymine
Thymine and cytosine
Adenine and guanine - Answers -Adenine and guanine
What is the rate of mutation per round of DNA replication?
1 in 1,000 base pairs
1 in 10,000 base pairs
1 in 1,000,000 base pairs
1 in 1,000,000,000 base pairs - Answers -1 in 1,000,000,000 base pairs
The rate of DNA migration through an agarose gel during electrophoresis does not
depend on which of the following factors?
Net charge of the molecule
Size of the molecule
Shape of the molecule
Nucleotide sequence of the molecule - Answers -Nucleotide sequence of the molecule
What are the phases in a qPCR Amplification Plot?
Initiation, exponential, plateau
Baseline, exponential, plateau
Baseline, threshold, exponential, plateau
Baseline, initiation, threshold, exponential, plateau - Answers -Initiation, exponential,
plateau
,Find the palindrome in this restriction enzyme site: 5'-CTGCAG-3'?
5'-GAC
3'-GAC
3'-CTG
5'-GTC - Answers -3'-GAC
A patient with impaired judgment, personality changes, signs of abnormal body
movements and depression comes to the physician's office for a follow-up visit. The
physician suspects a single-gene disorder may be the cause of those clinical
manifestations. A blood specimen was then sent to your clinical laboratory for mutation
screening in the Huntington gene. Testing with standard PCR indicates that patient has
Huntington Disease, HD. Which of the following would be consistent with this
diagnosis?
25 CAG repeats in the Huntington gene
85 CAG repeats in the Huntington gene
25 CGA repeats in the Huntington gene
85 CGA repeats in the Huntington gene - Answers -85 CAG repeats in the Huntington
gene
Which two HPV types are responsible for most cases of cervical cancer?
16 and 18
31 and 59
16 and 58
44 and 59 - Answers -16 and 18
Replication forks, known as origins of DNA replication, are created by this enzyme:
Ligase
Taq Polymerase
Primase
Helicase - Answers -Helicase
Mutation in what gene is associated with Fragile X syndrome? - Answers -FMR1
Mantle cell lymphoma (MCL) is caused by what translocation? - Answers -t(11;14)
This polymerase is involved in "initiation of DNA replication and has primase activity": -
Answers -Pol α
Its discovery shed light on why there is simultaneous, though not continuous, synthesis
of DNA on both leading and lagging strands of DNA:
Klenow fragment of DNA polymerase
Okazaki fragments
Sanger fragments
RNA fragments - Answers -Okazaki fragments
, What gene is measured following treatment with imatinib (Gleevec)?
FLT3
BCR/Abl
Jak2
MAPK - Answers -BCR/Abl
What is the rate of mammalian DNA replication?
500 nucleotides per second
100 nucleotides per second
50 nucleotides per second
10 nucleotides per second - Answers -50 nucleotides per second
This polymerase is involved in "replicates mitochondrial DNA": - Answers -Pol γ
A parent has an autosomal dominant disorder. What percent chance does this parent
have to pass down this affected gene to his/her child?
0%
25%
50%
75%
100% - Answers -50%
The phrase "central dogma of molecular biology" refers to the flow of genetic data in this
manner:
DNA --> RNA --> Proteins
DNA -->Proteins --> Genes
RNA --> DNA --> Proteins
RNA --> Proteins --> DNA - Answers -DNA --> RNA --> Proteins
What drug is NOT metabolized by CYP2D6?
Codeine
Omeprazole
Warfarin
Escitalopram - Answers -Warfarin
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
Frame-shift mutation
Insertion
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller GEEKA. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $12.99. You're not tied to anything after your purchase.