100% satisfaction guarantee Immediately available after payment Both online and in PDF No strings attached
logo-home
Previously searched by you
Previously searched by you
logo
BIOL 200 Final Exam Questions And Correct Answers 100% Verified. $11.49
Add to cart
Quickly navigate to
Preview
  2.  
  3. BIOL 200
  4.  
  5. BIOL 200

Exam (elaborations)

BIOL 200 Final Exam Questions And Correct Answers 100% Verified.
 0 purchase
  • Course
  • BIOL 200
  • Institution
  • BIOL 200

BIOL 200 Final Exam Questions And Correct Answers 100% Verified. After polymerization, the common element of an informational monomer becomes the ... - Answerpolymer backbone. After polymerization, the characteristic element of an informational monomer becomes the... - Answerpolymer's side cha...

[Show more]

Preview 4 out of 38  pages

Document information

  • January 21, 2025
  • 38
  • 2024/2025
  • Exam (elaborations)
  • Questions & answers

Subjects

  • biol 200 final exam questions and correct answers

Written for

  • BIOL 200
  • BIOL 200

Seller

avatar-seller
TheStar

Reviews received

Content preview

©THESTAR 2024/2025 ALL RIGHTS RESERVED.




BIOL 200 Final Exam Questions And
Correct Answers 100% Verified.



After polymerization, the common element of an informational monomer becomes the ... -
Answer✔polymer backbone.
After polymerization, the characteristic element of an informational monomer becomes the... -
Answer✔polymer's side chains
After polymerization, the joining sites of an informational monomer become the.... -
Answer✔covalently bound elements in the backbone
The number of joining sites dictates number and branching of polymerization. For each of the
following, describe the potential polymer:
1 joining site;
2 joining sites;

3 joining sites - Answer✔1. no polymerization
2. infinite linear polymerization
3. inifinite branched polymerization

Nucleotides - Answer✔Monomers of nucleic acids

L-amino acids - Answer✔Monomers of proteins

Nucleotide common element - Answer✔Pentose sugar phosphate

Nucleotide joining sites - Answer✔5' phosphate; 3' OH

Nucleotide characteristic elements - Answer✔Purine/pyrimidine heterocyclic bases

How does RNA differ from DNA? - Answer✔RNA common element is ribose sugar (2' OH & 3'
OH); DNA common element is deoxyribose sugar (3' OH only).

L-amino acids common element - Answer✔Alpha carbon

L-amino acid characteristic element - Answer✔Amino side chain "R"

1|Page

, ©THESTAR 2024/2025 ALL RIGHTS RESERVED.

L-amino acid joining sites - Answer✔Amino group (NH2); Carboxyl group (COOH)

Hydrophobic amino acids (8) - Answer✔Ala (Alanine), Val (Valine), Ile (Isoleucine), Leu
(Leucine), Met (Methionine), Phe (Phenylalanine), Tyr (Tyrosine), Trp (Tryptophan)

Hydrophilic amino acids (9) - Answer✔Ser (Serine), Thr (Threonine), Asn (Asparagine), Gln
(Glutamine), Arg (Arginine), His (Histidine), Lys (Lysine), Asp (Aspartic Acid), Glu (Glutamic Acid)

Special amino acids (3) - Answer✔Cys (Cysteine), Gly (Glycine), Pro (Proline)

DNA strands are held together by - Answer✔Hydrogen bonds between heterocyclic bases

How many H-bonds in an A - T base pair? - Answer✔2

How many H-bonds in a G-C base pair? - Answer✔3
Tm is the temperature at which DNA is 1/2 denatured. Tm increases with... -
Answer✔Proportion of G-C pairs and chain length

DNA polymerase generates DNA from a DNA template - Answer✔Replication

RNA polymerase generates RNA from a DNA template. - Answer✔Transcription

Ribosomes generate proteins from an RNA template. - Answer✔Translation

The 3' OH of the growing nucleic acid attacks which part of the incoming NTP? - Answer✔alpha
phosphate
True or False: Growing nucleic acid chains interact DIRECTLY with the incoming NTPs. -
Answer✔True. The 3' OH of the chain attacks the alpha phosphate of the incoming NTP.
True or False: Growing proteins interact DIRECTLY with the incoming aminoacyl tRNA. -
Answer✔False. tRNA acts as an adaptor between the template and growing chain.
True or False: In both Transcription and Replication, there are start and stop sites on the
template. - Answer✔False. This is only true for transcription. For replication, there are only
start sites.

Codon - Answer✔3 base sequence on mRNA that is translated into an amino acid.

Why do we say that the genetic code is redundant? - Answer✔There are 64 possible codons,
but only 20 amino acids.

Stop Codons - Answer✔Codons that do not code any amino acid. These are : UAA, UAG & UGA

Start Codon - Answer✔One codon codes for methionine: AUG. All proteins start their synthesis
with Met.

Proteins - Answer✔Linear polymers of amino acids joined by peptide bonds.

Primary Structure (protein) - Answer✔The specific sequence of amino acids.

2|Page

, ©THESTAR 2024/2025 ALL RIGHTS RESERVED.

Hydrophobic Effect - Answer✔Hydrophobic molecules in an aqueous solution aggregate.

Use entropy to explain the hydrophobic effect. - Answer✔Water molecules surrounding
hydrophobic molecules adopt a cage-like organization with high entropy. Coalescing
hydrophobic molecules reduces the number of low entropy water molecules, raising the overall
entropy.

Oil drop model of protein folding - Answer✔Proteins fold to minimize the contact of
hydrophobic amino acids with the aqueous (cellular) environment without help.

Secondary structure (protein) - Answer✔Local conformations of the polypeptide backbone.

Alpha-Helix - Answer✔A protein secondary structure in which the polypeptide backbone coils
into a spiral shape.
In an alpha helix, the carbonyl O of amino acid 'n' forms a ____ bond with the amino group H of
amino acid _____. - Answer✔Hydrogen; n+4
The tilted axis of hydrogen bonds in an alpha helix drives periodicity of ____ residues/turn. -
Answer✔3.6

Beta-Sheet - Answer✔Folding pattern found in many proteins in which neighboring regions of
the polypeptide chain associate side by side with each other through hydrogen bonds to give a
rigid, flattened structure.
In a beta sheet, ____ bonds link adjacent strands so that amino acids protrude _____ & _____
the plane of the sheet. - Answer✔Hydrogen; above & below
True or False: Secondary structures are mainly formed by covalent interactions. -
Answer✔False. Hydrogen bonding.

Tertiary Structure (proteins) - Answer✔The overall conformation of the polypeptide.
True or False: Most structure-driving interactions among amino acids in a protein are non-
covalent. - Answer✔True.

Sulfide Bonding - Answer✔A covalent bond interaction important to protein structure. Occurs
between Cysteine residues.

Motifs (proteins) - Answer✔Combinations of secondary structure forming distinct local 3D
structures.

How do you spot a potential coiled-coil motif? - Answer✔Indicated by heptad repeats: every
fourth chain in the amino acid sequence will be hydrophobic.
True or False: Motifs can be cut away from the rest of the protein and retain their structure. -
Answer✔False. The rest of the protein contributes to the stability of the local motif.



3|Page

, ©THESTAR 2024/2025 ALL RIGHTS RESERVED.

True or False: Domains can be cut away from the rest of the protein and retain their structure. -
Answer✔True. Domains are larger than motifs and contain sufficient structure maintaining
bonds to be independently stable.

Quaternary Structure (proteins) - Answer✔Multimeric aggregations of proteins into larger
structures.
The informational biopolymers DNA, RNA and protein all share some features, but differ in
others. Which of the following are common features, shared by all three?


A. The order of monomer addition during synthesis is directed by a template biopolymer.
B. During synthesis monomers are incorporated in groups of 3.
C. All contain a phosphate group in the polymer backbone.
D. During synthesis individual polymer chains are extended at only one of the two ends.
E. Monomer selection during chain growth is an indirect process involving an adaptor molecule.
- Answer✔A & D
Which of the following statements regarding "start" and "stop" signals apply to both
transcription and translation?


A. the start and stop signals are "read" (i.e., interpreted) by the ribosome.
B. the start and stop signals reside within nucleic acid molecules.
C. the start and stop signals are part of the genetic code codon table.
D. the start and stop signals reside in RNA.
E. start and stop signals are needed because the products must have a definite length and
sequence. - Answer✔B & E
The sequences of several short single-stranded DNA molecules are shown below. Imagine each
sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by
Watson-Crick base-pairs between the complementary bases. Which of these double-stranded
molecules would have the highest melting temperature (Tm)?


A. 5' ACTGAGTCTCTGACTAGTCT 3'
B. 5' ACTTAGTCTATGACTAGTCT 3'
C. 5' ACTTAATCTATGAATAGTCT 3'
D. 5' ACTGCGTCTCCGACTAGTCT 3'

4|Page

The benefits of buying summaries with Stuvia:

Guaranteed quality through customer reviews

Guaranteed quality through customer reviews

Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.

Quick and easy check-out

Quick and easy check-out

You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.

Focus on what matters

Focus on what matters

Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!

Frequently asked questions

What do I get when I buy this document?

You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.

Satisfaction guarantee: how does it work?

Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.

Who am I buying these notes from?

Stuvia is a marketplace, so you are not buying this document from us, but from seller TheStar. Stuvia facilitates payment to the seller.

Will I be stuck with a subscription?

No, you only buy these notes for $11.49. You're not tied to anything after your purchase.

Can Stuvia be trusted?

4.6 stars on Google & Trustpilot (+1000 reviews)

64419 documents were sold in the last 30 days

Founded in 2010, the go-to place to buy study notes for 15 years now

Start selling
$11.49
  • (0)
Add to cart
Added