logo-home
logo

Ctaccgtaatattcgacc - Study guides, Class notes & Summaries

Looking for the best study guides, study notes and summaries about Ctaccgtaatattcgacc? On this page you'll find 2 study documents about Ctaccgtaatattcgacc.

All 2 results

Sort by

MB ASCP Demo Practice Exam Questions With Correct Answers 2024

  • MB ASCP Demo Practice Exam Questions With Correct Answers 2024

  • Exam (elaborations) • 2 pages • 2024
  • Available in package deal
    • MB ASCP Demo Practice Exam Questions With Correct Answers 2024
    (0)
  • $10.99
  • + learn more
MB ASCP Demo Practice Exam Questions with complete solutions

  • MB ASCP Demo Practice Exam Questions with complete solutions

  • Exam (elaborations) • 2 pages • 2023
  • Available in package deal
    • MB ASCP Demo Practice Exam Questions with complete solutions 1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' A. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D....
    (0)
  • $12.49
  • + learn more