Microrna mirna - Study guides, Class notes & Summaries

Honors Biology First Semester Final Exam with Complete Solutions What is the term for the process by which cells convert atmospheric nitrogen into a usable form for plants? Nitrogen Fixation What is the name of the small RNA molecules that regulate gene expression by targeting mRNA for degradation? MicroRNA (miRNA) What is the term for the process in which an organism produces offspring that are genetically identical to itself? Asexual Reproduction What is the name of the...

AAB Molecular Diagnostics- Final Exam [100% PASS] /verified/ Nucleic Acid *Ans* grows by attachment of 5' phosphate group of the incoming nucleotide to the 3'hydroxyl group of the last nucleotide double stranded DNA *Ans* most energetically favorable state for DNA Purines *Ans* double-ring structure Adenine (A) + Guanine (G) Pyrimidine *Ans* single-ring structure Uracil (U)+ Cytosine Messenger RNA (mRNA) *Ans* -template for all protein synthesis -encode all information necessary to p...

Nucleic Acid grows by attachment of 5' phosphate group of the incoming nucleotide to the 3'hydroxyl group of the last nucleotide double stranded DNA most energetically favorable state for DNA Purines double-ring structure Adenine (A) + Guanine (G) Pyrimidine single-ring structure Uracil (U)+ Cytosine Messenger RNA (mRNA) -template for all protein synthesis -encode all information necessary to produce proteins Heterogeneous nuclear RNA primary product o...

Nucleic Acid grows by attachment of 5' phosphate group of the incoming nucleotide to the 3'hydroxyl group of the last nucleotide double stranded DNA most energetically favorable state for DNA Purines double-ring structure Adenine (A) + Guanine (G) Pyrimidine single-ring structure Uracil (U)+ Cytosine Messenger RNA (mRNA) -template for all protein synthesis -encode all information necessary to produce proteins Heterogeneous nuclear RNA primary product o...

AAB Molecular Diagnostics Exam With 100% Correct Answers 2024

GNRS 515 Advanced Pathophysiology Exam Questions with Correct Answers DNA replication - Answer-untwisted and zipped by hydrogen bonds being broken between two pairs DNA polymerase - Answer-pairs new bases, aka complementary base pairing (ATCG) Chromosome aberrations occur where? - Answer-occurs among number or structure Explain base pair substitution - Answer-mutation where ATCG base pairing is mixed Missense mutation - Answer-A base-pair substitution that results in a codon that codes ...

BIO 302 hw and practice Exam 2|30 Questions with Verified Answers Which form of control directly influences which mRNAs are selected by ribosomes for the synthesis of proteins? a. mRNA degradation control b.mRNA processing and localization control c. Protein activity control d. Transcriptional control e. Translational control - CORRECT ANSWER translation control Transcription regulators usually bind where on a DNA double helix? a. 3' End b. 5' End c. Major groove d. Minor gr...

BIO 250 Microbiology: Final Exam Questions and Answers Graded A+ 2023. A fat is called if all carbons of the fatty acid chain are single bonded to 2 other carbons and 2 hydrogens. a. Unsaturated b. Polyunsaturated c. Monounsaturated d. Saturated e. None of the choices are correct 17. The lipid group that serves as energy storage molecules are a. Prostaglandins b. Waxes c. Phospholipids d. Steroids e. Triglycerides 18. Which type of microscope does not use light in forming the speci...

BIO 302 hw and practice Exam 2|30 Questions with Verified Answers Which form of control directly influences which mRNAs are selected by ribosomes for the synthesis of proteins? a. mRNA degradation control b.mRNA processing and localization control c. Protein activity control d. Transcriptional control e. Translational control - CORRECT ANSWER translation control Transcription regulators usually bind where on a DNA double helix? a. 3' End b. 5' End c. Major groove d. Minor gr...

MB ASCP Demo Practice Exam Questions with complete solutions 1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' A. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D....