Microrna mirna - Study guides, Class notes & Summaries
Looking for the best study guides, study notes and summaries about Microrna mirna? On this page you'll find 24 study documents about Microrna mirna.
All 24 results
Sort by
-
Honors Biology First Semester Final Exam with Complete Solutions
- Exam (elaborations) • 17 pages • 2024
- Available in package deal
-
- $9.99
- + learn more
Honors Biology First Semester Final 
Exam with Complete Solutions 
 
What is the term for the process by which cells convert atmospheric nitrogen into a usable form 
for plants? 
 Nitrogen Fixation 
 
What is the name of the small RNA molecules that regulate gene expression by targeting mRNA 
for degradation? 
 MicroRNA (miRNA) 
 
What is the term for the process in which an organism produces offspring that are genetically 
identical to itself? 
 
 Asexual Reproduction 
 
What is the name of the...
-
AAB Molecular Diagnostics- Final Exam [100% PASS] /verified/
- Exam (elaborations) • 42 pages • 2024
- Available in package deal
-
- $10.19
- + learn more
AAB Molecular Diagnostics- Final Exam 
[100% PASS] /verified/ 
Nucleic Acid *Ans* grows by attachment of 5' phosphate group of the incoming nucleotide to 
the 3'hydroxyl group of the last nucleotide 
double stranded DNA *Ans* most energetically favorable state for DNA 
Purines *Ans* double-ring structure Adenine (A) + Guanine (G) 
Pyrimidine *Ans* single-ring structure Uracil (U)+ Cytosine 
Messenger RNA (mRNA) *Ans* -template for all protein synthesis 
-encode all information necessary to p...
-
AAB Molecular Diagnostics- Nicole's questions and answers
- Exam (elaborations) • 77 pages • 2024
- Available in package deal
-
- $15.99
- + learn more
Nucleic Acid 
grows by attachment of 5' phosphate group of the incoming nucleotide to the 3'hydroxyl group of the last nucleotide 
 
 
 
double stranded DNA 
most energetically favorable state for DNA 
 
 
 
Purines 
double-ring structure Adenine (A) + Guanine (G) 
 
 
 
Pyrimidine 
single-ring structure Uracil (U)+ Cytosine 
 
 
 
Messenger RNA (mRNA) 
-template for all protein synthesis 
-encode all information necessary to produce proteins 
 
 
 
Heterogeneous nuclear RNA 
primary product o...
-
AAB Molecular Diagnostics questions and answers(latest update)
- Exam (elaborations) • 77 pages • 2024
-
- $14.49
- + learn more
Nucleic Acid 
grows by attachment of 5' phosphate group of the incoming nucleotide to the 3'hydroxyl group of the last nucleotide 
 
 
 
double stranded DNA 
most energetically favorable state for DNA 
 
 
 
Purines 
double-ring structure Adenine (A) + Guanine (G) 
 
 
 
Pyrimidine 
single-ring structure Uracil (U)+ Cytosine 
 
 
 
Messenger RNA (mRNA) 
-template for all protein synthesis 
-encode all information necessary to produce proteins 
 
 
 
Heterogeneous nuclear RNA 
primary product o...
-
AAB Molecular Diagnostics Exam With 100% Correct Answers 2024
- Exam (elaborations) • 54 pages • 2024
- Available in package deal
-
- $13.99
- + learn more
AAB Molecular Diagnostics Exam With 100% Correct Answers 2024
Make study stress less painful
-
GNRS 515 Advanced Pathophysiology Exam Questions with Correct Answers
- Exam (elaborations) • 8 pages • 2024
- Available in package deal
-
- $8.99
- + learn more
GNRS 515 Advanced Pathophysiology 
Exam Questions with Correct Answers 
 
DNA replication - Answer-untwisted and zipped by hydrogen bonds being broken 
between two pairs 
DNA polymerase - Answer-pairs new bases, aka complementary base pairing (ATCG) 
Chromosome aberrations occur where? - Answer-occurs among number or structure 
Explain base pair substitution - Answer-mutation where ATCG base pairing is mixed 
Missense mutation - Answer-A base-pair substitution that results in a codon that codes ...
-
BIO 302 hw and practice Exam 2|30 Questions with Verified Answers,100% CORRECT
- Exam (elaborations) • 8 pages • 2024
-
- $10.49
- + learn more
BIO 302 hw and practice Exam 2|30 Questions with Verified Answers 
 
Which form of control directly influences which mRNAs are selected by ribosomes for the synthesis of proteins? 
 
a. mRNA degradation control 
b.mRNA processing and localization control 
c. Protein activity control 
d. Transcriptional control 
e. Translational control - CORRECT ANSWER translation control 
 
Transcription regulators usually bind where on a DNA double helix? 
 
a. 3' End 
b. 5' End 
c. Major groove 
d. Minor gr...
-
BIO 250 Microbiology: Final Exam Questions and Answers Graded A+ 2023.
- Exam (elaborations) • 34 pages • 2023
- Available in package deal
-
- $27.49
- + learn more
BIO 250 Microbiology: Final Exam Questions and Answers Graded A+ 2023. 
A fat is called if all carbons of the fatty acid chain are single bonded to 2 other 
carbons and 2 hydrogens. 
a. Unsaturated 
b. Polyunsaturated 
c. Monounsaturated 
d. Saturated 
e. None of the choices are correct 
17. The lipid group that serves as energy storage molecules are 
a. Prostaglandins 
b. Waxes 
c. Phospholipids 
d. Steroids 
e. Triglycerides 
18. Which type of microscope does not use light in forming the speci...
-
BIO 302 hw and practice Exam 2|30 Questions with Verified Answers,100% CORRECT
- Exam (elaborations) • 8 pages • 2024
-
- $10.49
- + learn more
BIO 302 hw and practice Exam 2|30 Questions with Verified Answers 
 
Which form of control directly influences which mRNAs are selected by ribosomes for the synthesis of proteins? 
 
a. mRNA degradation control 
b.mRNA processing and localization control 
c. Protein activity control 
d. Transcriptional control 
e. Translational control - CORRECT ANSWER translation control 
 
Transcription regulators usually bind where on a DNA double helix? 
 
a. 3' End 
b. 5' End 
c. Major groove 
d. Minor gr...
-
MB ASCP Demo Practice Exam Questions with complete solutions
- Exam (elaborations) • 2 pages • 2023
- Available in package deal
-
- $12.49
- + learn more
MB ASCP Demo Practice Exam Questions with complete solutions 
1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? 
A. 5'-ATCTATGTCGGCAATT-3' 
B. 5'-TTAACGGCTGTATCTA-3' 
C. 5'-AATTGCCGACATAGAT-3' 
D. 5'-GAGCACGCTATCTTAT-3' 
A. 5'-ATCTATGTCGGCAATT-3' 
 
 
 
2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 
A. 60°C 
B. 58°C 
C. 64°C 
D....
Study stress? For sellers on Stuvia, these are actually golden times. KA-CHING! Earn from your study resources too and start uploading now. Discover all about earning on Stuvia