Garantie de satisfaction à 100% Disponible immédiatement après paiement En ligne et en PDF Tu n'es attaché à rien 4.2 TrustPilot
logo-home
Examen

(MB) ASCP Practice Exam Questions DUE 23 OCTOBER 2023

Note
-
Vendu
-
Pages
24
Grade
A+
Publié le
23-10-2023
Écrit en
2023/2024

(MB) ASCP Practice Exam Questions DUE 23 OCTOBER 2023 Which of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base - CORRECT ANSWER-Anti-codon According to Chargaff's rule of base pairing, adenine pairs with: - CORRECT ANSWERThymine What genes would be screened in a breast cancer panel? - CORRECT ANSWERHER2, ERBB2, BRCA1 Next Generation Sequencing uses: - CORRECT ANSWER-Short sequence reads Purines and pyrimidines differ from each other in that: - CORRECT ANSWER-Purines have two rings; pyrimidines have one ring The purines are: Cytosine and uracil Adenine and thymine Thymine and cytosine Adenine and guanine - CORRECT ANSWER-Adenine and guanine What is the rate of mutation per round of DNA replication? 1 in 1,000 base pairs 1 in 10,000 base pairs 1 in 1,000,000 base pairs 1 in 1,000,000,000 base pairs - CORRECT ANSWER-1 in 1,000,000,000 base pairs The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? Net charge of the molecule Size of the molecule Shape of the molecule Nucleotide sequence of the molecule - CORRECT ANSWER-Nucleotide sequence of the molecule What are the phases in a qPCR Amplification Plot? Initiation, exponential, plateau Baseline, exponential, plateau Baseline, threshold, exponential, plateau Baseline, initiation, threshold, exponential, plateau - CORRECT ANSWER-Initiation, exponential, plateau Find the palindrome in this restriction enzyme site: 5'-CTGCAG-3'? 5'-GAC 3'-GAC 3'-CTG 5'-GTC - CORRECT ANSWER-3'-GAC A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntington gene. Testing with standard PCR indicates that patient has Huntington Disease, HD. Which of the following would be consistent with this diagnosis? 25 CAG repeats in the Huntington gene 85 CAG repeats in the Huntington gene 25 CGA repeats in the Huntington gene 85 CGA repeats in the Huntington gene - CORRECT ANSWER-85 CAG repeats in the Huntington gene Which two HPV types are responsible for most cases of cervical cancer? 16 and 18 31 and 59 16 and 58 44 and 59 - CORRECT ANSWER-16 and 18 Replication forks, known as origins of DNA replication, are created by this enzyme: Ligase Taq Polymerase Primase Helicase - CORRECT ANSWER-Helicase Mutation in what gene is associated with Fragile X syndrome? - CORRECT ANSWERFMR1 Mantle cell lymphoma (MCL) is caused by what translocation? - CORRECT ANSWERt(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": - CORRECT ANSWER-Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments - CORRECT ANSWER-Okazaki fragments What gene is measured following treatment with imatinib (Gleevec)? FLT3 BCR/Abl Jak2 MAPK - CORRECT ANSWER-BCR/Abl What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second - CORRECT ANSWER-50 nucleotides per second This polymerase is involved in "replicates mitochondrial DNA": - CORRECT ANSWERPol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation-specific PCR Standard PCR PFGE RAPD PCR - CORRECT ANSWER-Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22-25ºC 2-8ºC -20ºC -70ºC - CORRECT ANSWER--70ºC Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp - CORRECT ANSWER-m/+ = 350 bp; 250 bp; 100 bp Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 75°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer - CORRECT ANSWER-Increase the concentration of salt in the wash solution buffer What enzyme is involved in LCR? - CORRECT ANSWER-DNA Ligase Next Generation Sequencing set-up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors Hybridization - CORRECT ANSWER-Library preparation and extensive bioinformatics analysis Which of the subunits of RNA polymerase holoenzyme is responsible for promoter recognition? Beta subunit Sigma subunit Gamma subunit Delta subunit - CORRECT ANSWER-Sigma subunit While at the doctor's office with your father, you overheard his physician tell another physician that test results came in, confirming the presence of the Factor V Leiden mutation, a mutation associated with deep venous thrombosis. Which of the following is the mutation your father has: A1691G G1619A 1691G>A C282Y - CORRECT ANSWER-1691G>A Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C - CORRECT ANSWER-58°C This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II - CORRECT ANSWER-RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the betaglobin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: - CORRECT ANSWER-Pleiotrophy What assay amplifies the target using a combination of a three-enzyme system? Branched DNA TMA PCR NASBA LCR - CORRECT ANSWER-NASBA In what part of a qPCR Amplification Plot do you take your measurement? - CORRECT ANSWER-Exponential phase All of the following are liquid tumors, except: Mantle cell lymphoma Ewing sarcoma Burkitt's lymphoma Acute promyelocytic leukemia - CORRECT ANSWER-Ewing sarcoma A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is: - CORRECT ANSWER-(2.545 * 50ng/mcl)= 127.25 (127.25ng/mcl * 0.30) = 38.175ng/mcl 38.175ng/mcl ( 0.800mL1000) = 3054 micrograms According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair with: U or C A or G A, C or G Only A - CORRECT ANSWER-A or G This polymerase acts on DNA and produces Messenger RNA: - CORRECT ANSWERRNA Pol II What assay amplifies the probe signal and the probe RNA concentration increases if the target to be detected is present? Branched DNA TMA PCR NASBA LCR Qβ replicase - CORRECT ANSWER-Qβ replicase This restriction enzyme "digests and adds a methyl group from Adenine": Type I Type II Type III DNase I - CORRECT ANSWER-Type III What increases the half-life of mRNA? 5' Methyl Cap 3' Methyl Cap Poly-A tail 5' Methionine Cap - CORRECT ANSWER-5' Methyl Cap A parent has an autosomal dominant disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% - CORRECT ANSWER-50% The phrase "central dogma of molecular biology" refers to the flow of genetic data in this manner: DNA --> RNA --> Proteins DNA -->Proteins --> Genes RNA --> DNA --> Proteins RNA --> Proteins --> DNA - CORRECT ANSWER-DNA --> RNA --> Proteins What drug is NOT metabolized by CYP2D6? Codeine Omeprazole Warfarin Escitalopram - CORRECT ANSWER-Warfarin You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: Frame-shift mutation Insertion Silent mutation Non-conservative mutation - CORRECT ANSWER-Frame-shift mutation A parent has an autosomal recessive disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% - CORRECT ANSWER-100% Which DNA polymerase is responsible for copying DNA by reading existing strand, building new complementary strand and always adds to 3' end, but can't start a new strand on its own (ORI sites)? DNA Polymerase III DNA Polymerase I Gyrase None of the choices listed - CORRECT ANSWER-DNA Polymerase III How many log10 reductions in HIV viral load is considered to be successful upon treatment? 0.5log10 1log10 2log10 3log10 - CORRECT ANSWER-0.5log10 Which of the following is not a characteristic of a tRNA molecule? D arm Beta arm T arm Anti-codon arm - CORRECT ANSWER-Beta arm

Montrer plus Lire moins
Établissement
ASCP
Cours
ASCP










Oups ! Impossible de charger votre document. Réessayez ou contactez le support.

École, étude et sujet

Établissement
ASCP
Cours
ASCP

Infos sur le Document

Publié le
23 octobre 2023
Nombre de pages
24
Écrit en
2023/2024
Type
Examen
Contient
Questions et réponses

Sujets

€7,48
Accéder à l'intégralité du document:

Garantie de satisfaction à 100%
Disponible immédiatement après paiement
En ligne et en PDF
Tu n'es attaché à rien

Faites connaissance avec le vendeur
Seller avatar
SpectraLearning
5,0
(1)

Faites connaissance avec le vendeur

Seller avatar
SpectraLearning NURSING
S'abonner Vous devez être connecté afin de suivre les étudiants ou les cours
Vendu
8
Membre depuis
2 année
Nombre de followers
4
Documents
454
Dernière vente
1 mois de cela
The Education Revolution

W have launched our assignments at a very reasonable price so that every student can enjoy its features. Our new method is gathering quite a positive feedback from the students, and many of our alumnus are fully satisfied with it.

5,0

1 revues

5
1
4
0
3
0
2
0
1
0

Pourquoi les étudiants choisissent Stuvia

Créé par d'autres étudiants, vérifié par les avis

Une qualité sur laquelle compter : rédigé par des étudiants qui ont réussi et évalué par d'autres qui ont utilisé ce document.

Le document ne convient pas ? Choisis un autre document

Aucun souci ! Tu peux sélectionner directement un autre document qui correspond mieux à ce que tu cherches.

Paye comme tu veux, apprends aussitôt

Aucun abonnement, aucun engagement. Paye selon tes habitudes par carte de crédit et télécharge ton document PDF instantanément.

Student with book image

“Acheté, téléchargé et réussi. C'est aussi simple que ça.”

Alisha Student

Foire aux questions