Loc b2 Study guides, Class notes & Summaries

MB (ASCP) TEST VERIFIED SOLUTIONS 100% GUARANTEE PASS Consider the table below where a child and a possible father (PF) share the listed paternity indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Locus Tested PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 15/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2, LOC-C3 and LOC-D4? 12.42 9.558 ...

Consider the table below where a child and a possible father (PF) share the listed paternity indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Locus Tested PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 15/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2, LOC-C3 and LOC-D4? 12.42 9.558 15.56 2.38 - Answer- 12.42 ( CPI is calculated by multiplyi...

Consider the table below where a child and a possible father (PF) share the listed paternity indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Locus Tested PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 15/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2, LOC-C3 and LOC-D4? 12.42 9.558 15.56 2.38 12.42 ( CPI is calculated by multiplying all Pate...

Consider the table below where a child and a possible father (PF) share the listed paternity indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Locus Tested PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 15/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2, LOC-C3 and LOC-D4? 12.42 9.558 15.56 2.38 12.42 ( CPI is calculated by multiplying all Pate...

MB (ASCP) 2022 Questions and Answers Rated A Consider the table below where a child and a possible father (PF) share the listed paternity indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Locus Tested PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 15/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2, LOC-C3 and LOC-D4? 12.42 9.558 15.56 2.38 12.42 ...

Which PCR method has the highest specificity? A. qPCR B. Touchdown PCR C. Nested PCR D. Two-step PCR Nested PCR Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' 5'-ATCTATGTCGGCAATT-3' During DNA replication, the 3' -OH of the growing DNA chain attacks which phosphate of an incoming nucleotide? A. Alpha ...

MB ASCP CONNECT Questions and Answers 100% correct What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90...

MB ASCP CONNECT Question and Answer 100% Correct What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) - t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% ...

MB ASCP CONNECT Question and Answer 100% Correct What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) - t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% ...

MB ASCP Demo Practice Exam Questions with complete solutions 1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' A. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D....