Loc c3 Study guides, Class notes & Summaries

Acute Brain Injury - Answer- An injury to the brain that is not hereditary, congenital, degenerative, or induced by birth trauma Traumatic Brain Injury - Answer- An alteration in brain function, or other evidence of brain pathology, caused by an external force 2 Mechanisms *trauma impact * traumatic inertial forces Non-traumatic brain injury - Answer- Lack of O2, decreased nutrients to cells, exposure to toxins, pressure from tumor or blockage or other neuro disorder ABI Prevalenc...

MB ASCP CONNECT Question and Answer 100% Correct What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) - t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% ...

MB ASCP CONNECT Question and Answer 100% Correct What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) - t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% ...

MB ASCP Demo Practice Exam Questions with complete solutions 1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' A. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D....

What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% 92.5 % Multiply all PI together =...

What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5%b. 99.5% c. 90.5 & d. 95.5% 92.5 % Multiply all PI together = CPI (CPI x PP) / [C...

BKAT Study Set Questions with Complete Solutions Normal blood gases; pH - ANSWER 7.35-7.45 Normal blood gases: CO2 - ANSWER 35-45 Normal blood gases: HcO3 - ANSWER 22-26 Normal blood gases: PO2 - ANSWER 80 or above Normal vacuum pressures for suction? - ANSWER 120-140 mmHg What may a high pressure vent alarm indicate? - ANSWER Pt is biting on the tubing, excessive secretions in the tubing, kinked tubing What may a low pressure vent alarm indicate? - ANSWER cuff leak or the tubing is...

MB (ASCP) 2020 GRADED A+ TO PASSConsider the table below where a child and a possible father (PF) share the listed paternity indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Locus Tested PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 15/17 9/17 5.21 LOC-D.37 Based on the data presented in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2, LOC-C3 and LOC-D4? 12.42 9.558 15.56 2.38 12.42 ( CPI is calculate...

EEG BOARD Prep (Part 1) The basic unit for measuring current flow is: a. atomic weight b. Coulomb c. Volt d. Ampere d. ampere The basic unit of resistance is: a. Ohm b. Coulomb c. Ampere d. Volt a. ohm Which of the following is NOT a valid expression of Ohm's Law: a. R=EI or (R=VI) b. E=IR or (V=IR) c. I=E/R or (I=V/R) d. R=E/I or (R=V/I) a. R=EI or (R=VI) Which of the following is NOT a unit for measuring alternating frequencies: a. cycles per second b. volts c. hertz ...

EEG BOARD Prep (Part 1) The basic unit for measuring current flow is: a. atomic weight b. Coulomb c. Volt d. Ampere d. ampere The basic unit of resistance is: a. Ohm b. Coulomb c. Ampere d. Volt a. ohm Which of the following is NOT a valid expression of Ohm's Law: a. R=EI or (R=VI) b. E=IR or (V=IR) c. I=E/R or (I=V/R) d. R=E/I or (R=V/I) a. R=EI or (R=VI) Which of the following is NOT a unit for measuring alternating frequencies: a. cycles per second b. volts c. hertz ...