Mbascp - Study guides, Class notes & Summaries

Looking for the best study guides, study notes and summaries about Mbascp? On this page you'll find 39 study documents about Mbascp.

Page 4 out of 39 results

Sort by

MB ASCP CONNECT(edited version).
  • MB ASCP CONNECT(edited version).

  • Exam (elaborations) • 38 pages • 2023
  • MB ASCP CONNECT(edited version).What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) ANSWER- t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% AN...
    (0)
  • $11.49
  • + learn more
MB ASCP Test Molecular Techniques (20-30%) 100% Correct Answers.
  • MB ASCP Test Molecular Techniques (20-30%) 100% Correct Answers.

  • Exam (elaborations) • 12 pages • 2023
  • MB ASCP Test Molecular Techniques (20-30%) 100% Correct Answers. What are the 3 types of gel electrophoresis -ANSWER Agarose Polyacrylamide Pulse Field What is gel electrophoresis -ANSWER the separation of materials based on size and migration patterns when subjected to electrical forces in a resistive medium. which direction does the DNA flow in gel electrophoresis -ANSWER due to DNA being negatively charged, it will migrate towards the positive end What determines how far the DNA w...
    (0)
  • $10.49
  • + learn more
ASCP BOC EXAM Study Guide
  • ASCP BOC EXAM Study Guide

  • Exam (elaborations) • 11 pages • 2023
  • ASCP BOC EXAM Study GuideWhen using an electronic cell counter, which of the following results can occur in the presence of a cold agglutination? a) increased MCV and decreased RBC b) increased MCV and normal RBC c) decreased MCV and increased MCHC d) decreased MCV and RBC - ANSWERa) increased MCV and decreased RBC Cerebrospinal fluid for glucose assay should be: a) refrigerated b) analyzed immediately c) heated to 56 degree C d) stored at room temp after centrifugation - ANSWERb) analyzed im...
    (0)
  • $10.49
  • + learn more
Molecular Diagnostics Chapter 11 ORIGINAL VERSION.
  • Molecular Diagnostics Chapter 11 ORIGINAL VERSION.

  • Exam (elaborations) • 5 pages • 2023
  • Available in package deal
  • Molecular Diagnostics Chapter 11 ORIGINAL VERSION. What are examples of PCR inhibitors? - ANSWERS.hemoglobin, acidic polysacharrides, nitrate, crystals, beta-human chorionic gonadatropin, heparin, lactoferrin, anticoagulants, sodium polyanethol sulfonate, and polyamines STAR - ANSWERS.stool transport and recovery buffer inactivates infectious organisms What is the purpose of a sensitivity control? - ANSWERS.shows lower limit of detection true negative - ANSWERS.Indicates accurately tha...
    (0)
  • $8.99
  • + learn more
MB ASCP Ch 13 Molecular Detection of Inherited Diseases Estimatics Exam.
  • MB ASCP Ch 13 Molecular Detection of Inherited Diseases Estimatics Exam.

  • Exam (elaborations) • 5 pages • 2023
  • MB ASCP Ch 13 Molecular Detection of Inherited Diseases Estimatics En polymorphisms -ANSWER mutations useful for mapping, determining parentage balanced polymorphisms -ANSWER just a DNA sequence difference, the phenotypic effect of which is counteracted by a second trait or polymorphism methylation -ANSWER usually cytosine in CpG islands, shuts down RNA transcription by adding methyl groups genomic impringing -ANSWER enzymatic addition of methyl groups to specific nitrogen bases in a pr...
    (0)
  • $9.49
  • + learn more
Molecular Diagnostics Chapter 13 Assessment.
  • Molecular Diagnostics Chapter 13 Assessment.

  • Exam (elaborations) • 6 pages • 2023
  • Available in package deal
  • Molecular Diagnostics Chapter 13 Assessment.Oncogenes genes that cause cancer by blocking the normal controls on cell reproduction, oncogenes prevent apoptosis
    (0)
  • $10.99
  • + learn more
Molecular Diagnostics Chapter 7(All Correct Answers Avaible).
  • Molecular Diagnostics Chapter 7(All Correct Answers Avaible).

  • Exam (elaborations) • 5 pages • 2023
  • Available in package deal
  • Molecular Diagnostics Chapter 7(All Correct Answers Avaible)chromosome mutation - ANSWERS.change in chromosome structure Genome mutations - ANSWERS.changes in chromosome number Euploid - ANSWERS.an individual with How many base pairs are in the human genome? - ANSWERS.2.9 billion What is the difference between a mutation and a polymorphism? - ANSWERS.mutations are reserved for rare changes in DNA like those found in cancer. Polymorphisms are variants that occur in 1-2% of the population...
    (0)
  • $9.99
  • + learn more
MB ASCP Chapter 1 Study Questions and Answers.
  • MB ASCP Chapter 1 Study Questions and Answers.

  • Exam (elaborations) • 3 pages • 2023
  • MB ASCP Chapter 1 Study Questions and Answers.What is the function of DNA in the cell - aANSWERCarry genetic information How do purines and pyrimidines - aANSWERPurines have double ring; pyrimidines have a single ring Write the complementary sequence for the following DNA sequence 5' AGGTCACGTCTAGCTAGCTAGA 3' - aANSWER5' AGGTCACGTCTAGCTAGCTAGA 3' Answer: 5' TCTAGCTAGCTAGACGTGACCT 3' Which of the ribose carbons participate in the phosphodiester bond - aANSWERThe 5' ribose carbon...
    (0)
  • $8.99
  • + learn more
MB ASCP Demo Practice Exam Questions
  • MB ASCP Demo Practice Exam Questions

  • Exam (elaborations) • 2 pages • 2023
  • MB ASCP Demo Practice Exam Questions1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' - ANSWERA. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D. 62°C - ANSWERB. 58°C ...
    (0)
  • $7.99
  • + learn more