Rédigé par des étudiants ayant réussi Disponible immédiatement après paiement Lire en ligne ou en PDF Mauvais document ? Échangez-le gratuitement 4,6 TrustPilot
logo-home
Examen

MB ASCP CONNECT QUESTIONS AND ANSWERS GRADED A 2024

Note
-
Vendu
-
Pages
52
Grade
A+
Publié le
21-02-2024
Écrit en
2023/2024

MB ASCP CONNECT QUESTIONS AND ANSWERS GRADED A What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) - Answer ️️ -t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% - Answer ️️ -92.5 % Multiply all PI together = CPI (CPI x PP) / [CPI x P + (1 - PP) OR ... CPI / (1 + CPI) You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: a. Frame-shift mutation b. Insertion c. Silent mutation d. Non-conservative mutation - Answer ️️ -Frame-shift mutation Which of the following is not involved in the splicing reaction? a. 5' splice site b. Hairpin loops c. Branch A point d. 3' splice site - Answer ️️ -Hairpin loops Which of the following statements are characteristics of the melt curve analysis? (hint: more than one answer) a. At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. b. The melting temperature of double stranded DNA depends on its base composition and length. c. All PCR products for a specific primer pair should have the same melting temperature. d. When hybridization probes are utilized, the temperature is incrementally decreased while fluorescence is monitored. - Answer ️️ -At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. The melting temperature of double stranded DNA depends on its base composition and length. All PCR products for a specific primer pair should have the same melting temperature. In the field of molecular diagnostics, which one of the following genes is responsible for the synthesis of DNA, promote cell division, and inhibit cell death? a. Proto-oncogenes b. Tumor suppressor genes c. Oncogenes d. Mitochondrial genes - Answer ️️ -Proto-oncogenes Microsatellite instability is best described as: a. The ability of a gene with repeating elements of 8-10 base pairs to randomly mutate b. Contraction or expansion of the genome caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs c. Repetitive elements in the genome with the ability to self-prime, thus creating additional copies of genetic material at the allele loci d. Random gene rearrangement between repeating elements of the same size on different chromosomes resulting in different size gene products - Answer ️️ -Contraction or expansion of the genome caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs Purines and pyrimidines differ from each other in that: a. Purines are found RNA; pyrimidines are found in DNA b. There's no difference between purines and pyrimidines c. Pyrimidines have two rings; purines have one ring d. Purines have two rings; pyrimidines have one ring - Answer ️️ -Purines have two rings; pyrimidines have one ring TIP: Reciprocals of each other. Purine, shorter word, longer rings. Pyrimidine, longer word, shorter ring. Which of the following molecular methodologies would be the best for detecting a trinucleotide repeat disorder such as Huntington's disease? a. Heteroduplex analysis b. Variable number tandem repeat analysis c. Single strand conformation polymorphism analysis d. Reverse-Transcriptase PCR - Answer ️️ -Variable number tandem repeat analysis Locus Test C M PF1 PF2 A1 12/15 12 15/17 12/15 B2 13 13/13 13/15 14/15 C3 7/8 8 7 7/7 D4 9/11 9/9 10/11 11 E5 6 6/6 5/7 6 Based on the results above, which one of the two possible fathers is the two-month old's biological father? a. Possible Father 1 b. Possible Father 2 c. Neither of the Possible Fathers - Answer ️️ -Neither Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: a. Pleiotrophy b. Polygenic inheritance c. Epistasis d. Epigenetics - Answer ️️ -Pleiotrophy A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is: a. 3540 micrograms b. 3450 micrograms c. 3504 micrograms d. 3054 micrograms - Answer ️️ -3054 ug 260 reading x 50 ug/ml (DNA) x dilution factor x resupsension = DNA Yield 260 x 50 x 30 x 0.8 = 3054 When sequencing HLA-DR what is targeted? a. Exon 1 of the α subunit b. Exon 2 of the α subunit c. Exon 1 of the β subunit d. Exon 2 of the β subunit - Answer ️️ -Exon 2 of the β subunit All of the following are components of nucleic acids, EXCEPT: a. Phosphate group b. Sugar (ribose or deoxyribose) c. Nitrogenous base (A, G, C, T) d. Formamide - Answer ️️ -Formamide This polymerase acts on DNA and produces Transfer RNA: a. RNA Pol II b. DNA Pol II c. RNA Pol III d. DNA Pol III - Answer ️️ -RNA pol III

Montrer plus Lire moins
Établissement
ASCP MB
Cours
ASCP MB











Oups ! Impossible de charger votre document. Réessayez ou contactez le support.

École, étude et sujet

Établissement
ASCP MB
Cours
ASCP MB

Infos sur le Document

Publié le
21 février 2024
Nombre de pages
52
Écrit en
2023/2024
Type
Examen
Contient
Questions et réponses

Sujets

€13,19
Accéder à l'intégralité du document:

Mauvais document ? Échangez-le gratuitement Dans les 14 jours suivant votre achat et avant le téléchargement, vous pouvez choisir un autre document. Vous pouvez simplement dépenser le montant à nouveau.
Rédigé par des étudiants ayant réussi
Disponible immédiatement après paiement
Lire en ligne ou en PDF


Document également disponible en groupe

Faites connaissance avec le vendeur

Seller avatar
Les scores de réputation sont basés sur le nombre de documents qu'un vendeur a vendus contre paiement ainsi que sur les avis qu'il a reçu pour ces documents. Il y a trois niveaux: Bronze, Argent et Or. Plus la réputation est bonne, plus vous pouvez faire confiance sur la qualité du travail des vendeurs.
EmilyCharlene Teachme2-tutor
S'abonner Vous devez être connecté afin de suivre les étudiants ou les cours
Vendu
490
Membre depuis
2 année
Nombre de followers
138
Documents
23000
Dernière vente
1 jours de cela
Charlene\'s Scholastic Emporium.

Your Actual and Virtual Exam Tests Excellent Tutor.

3,7

110 revues

5
51
4
18
3
16
2
7
1
18

Documents populaires

Récemment consulté par vous

Pourquoi les étudiants choisissent Stuvia

Créé par d'autres étudiants, vérifié par les avis

Une qualité sur laquelle compter : rédigé par des étudiants qui ont réussi et évalué par d'autres qui ont utilisé ce document.

Le document ne convient pas ? Choisis un autre document

Aucun souci ! Tu peux sélectionner directement un autre document qui correspond mieux à ce que tu cherches.

Paye comme tu veux, apprends aussitôt

Aucun abonnement, aucun engagement. Paye selon tes habitudes par carte de crédit et télécharge ton document PDF instantanément.

Student with book image

“Acheté, téléchargé et réussi. C'est aussi simple que ça.”

Alisha Student

Foire aux questions