Garantie de satisfaction à 100% Disponible immédiatement après paiement En ligne et en PDF Tu n'es attaché à rien
logo-home
Recherché précédemment par vous
Recherché précédemment par vous
logo
ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE 10,17 €   Ajouter au panier
Accédez rapidement à
Aperçu
  2.  
  3. ASCP
  4.  
  5. ASCP

Examen

ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE

2 revues
 9 vues  0 achat
  • Cours
  • ASCP
  • Établissement
  • ASCP

ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE

Aperçu 3 sur 28  pages

Infos sur le Document

  • 15 mai 2024
  • 28
  • 2023/2024
  • Examen
  • Questions et réponses

Sujets

  • ascp practice exam questions latest updated
  • ascp practice exam questions
  • ascp practice exam questions and answers
  • ascp practice exam graded a
  • ascp practice exam questions expert verified

École, étude et sujet

  • ASCP
  • ASCP

2  revues

review-writer-avatar

Par: RegisteredNurse • 1 mois de cela

It is detailed, quality information and I passed

review-writer-avatar

Par: RegisteredNurse • 4 mois de cela

The content provided is top-notch and worth every penny. I highly recommend.

Vendeur

avatar-seller
DrBellaPhD

Avis reçus

Aperçu du contenu

ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE Mutation in what gene is associated with Fragile X syndrome? FMR1 Mantle cell lymphoma (MCL) is caused by what translocation? t(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments Okazaki fragments What gene is mea sured following treatment with imatinib (Gleevec)? FLT3 BCR/Abl Jak2 MAPK BCR/Abl What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second 50 nucleotides per se cond This polymerase is involved in "replicates mitochondrial DNA": Pol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow -up visit. The physician suspects a single -
gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation -specific PCR Standard PCR PFGE RAPD PCR Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22-25ºC 2-8ºC -20ºC -70ºC -70ºC Consider a hypothetical mutation involving gene X. Let's say you a mplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp m/+ = 350 bp; 250 bp; 100 bp Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 7 5°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer Increase the concentration of salt in the wash solution buffer What enzyme is involved in LCR? DNA Ligase Next Generation Sequencing set -up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors Hybridization Library preparation and extensive bioinformatics analysis Which of the subunits of RNA polym erase holoenzyme is responsible for promoter recognition? Beta subunit Sigma subunit Gamma subunit Delta subunit Sigma subunit While at the doctor's office with your father, you overheard his physician tell another physician that test results came in, conf irming the presence of the Factor V Leiden mutation, a mutation associated with deep venous thrombosis. Which of the following is the mutation your father has: A1691G G1619A 1691G>A C282Y 1691G>A Consider the probe sequence, CTACCGTAATATTCGACCGT, to be use d in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C 58°C This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta -globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a

Les avantages d'acheter des résumés chez Stuvia:

Qualité garantie par les avis des clients

Qualité garantie par les avis des clients

Les clients de Stuvia ont évalués plus de 700 000 résumés. C'est comme ça que vous savez que vous achetez les meilleurs documents.

L’achat facile et rapide

L’achat facile et rapide

Vous pouvez payer rapidement avec iDeal, carte de crédit ou Stuvia-crédit pour les résumés. Il n'y a pas d'adhésion nécessaire.

Focus sur l’essentiel

Focus sur l’essentiel

Vos camarades écrivent eux-mêmes les notes d’étude, c’est pourquoi les documents sont toujours fiables et à jour. Cela garantit que vous arrivez rapidement au coeur du matériel.

Foire aux questions

Qu'est-ce que j'obtiens en achetant ce document ?

Vous obtenez un PDF, disponible immédiatement après votre achat. Le document acheté est accessible à tout moment, n'importe où et indéfiniment via votre profil.

Garantie de remboursement : comment ça marche ?

Notre garantie de satisfaction garantit que vous trouverez toujours un document d'étude qui vous convient. Vous remplissez un formulaire et notre équipe du service client s'occupe du reste.

Auprès de qui est-ce que j'achète ce résumé ?

Stuvia est une place de marché. Alors, vous n'achetez donc pas ce document chez nous, mais auprès du vendeur DrBellaPhD. Stuvia facilite les paiements au vendeur.

Est-ce que j'aurai un abonnement?

Non, vous n'achetez ce résumé que pour 10,17 €. Vous n'êtes lié à rien après votre achat.

Peut-on faire confiance à Stuvia ?

4.6 étoiles sur Google & Trustpilot (+1000 avis)

74735 résumés ont été vendus ces 30 derniers jours

Fondée en 2010, la référence pour acheter des résumés depuis déjà 14 ans

Commencez à vendre!

Récemment vu par vous

Examen ·

(0)

Scuba Diving Final Exam 2022 with complete solution

10,17 €
  • (2)
  Ajouter