Splicing of mrna - Study guides, Revision notes & Summaries

Bio 115 Final Exam- WVU Questions and Answers Already Passed How can one eukaryotic gene lead to one transcript, but multiple different proteins? Alternative splicing What is the primary transcript of eukaryotic genes? mRNA What is the attachment site for RNA polymerase? Promoter region Gene regulation in both prokaryotes and eukaryotes is achieved by controlling which process? transcription A eukaryotic gene has all of the following except: introns, a promoter, an operator, ...

which of the following components of an amino acid differs from one amino acid to another - Answerthe R group Sometimes atoms gain or lose particles. The loss of which of the following would result in a change of overall electrical charge? - Answer-protons or electrons what is the cell theory - Answer-1. theof cells A pair of shared valence electrons is referred to as a(n) - Answer-covalent bond scientists wanted to track the movement of specific organic molecules in a cell by using radioac...

Bs161 final 2024 Exam Questions With Answers In messenger RNA, the protein-coding sequence is present in: Question options: exons. introns. exons and the poly(A) sequence. introns and the poly(A) sequence. - ANSWER exons. Which process produces multiple proteins from the same primary transcript in the same cell? Question options: chromatin remodeling histone modification alternative splicing combinatorial control - ANSWER alternative splicing Alternative splicing allow...

In E. coli, 5S rRNA is cleaved out of the pre-rRNA operon by: a. RNase III b. RNase E Correct Answer-RNase E The 5' cap: a. Does not play a role in translation b. Interacts with the poly A tail during transport out of the nucleus c. Protects the mRNA from 5' exonucleases d. Is acetylated e. Is sometimes found on E. coli mRNA Correct Answer-Protects the mRNA from 5' exonucleases The addition of the poly A tail: a. Occurs during the elongation phase of transcription b. Occurs during...

Based on what we learned about the most important splicing consensus sequences, what will the sequence of this simplified intron-containing mRNA (written from 5' to 3', left to right) be after splicing occurs? (Don't write anything besides nucleotide letters.) CAAGGUCCCUCCCACCUAGCAA correct answersCAAGCAA, caagcaa, Caagcaa, CaagCaa Which of the following Before/After statements best describes the change in scientific knowledge brought about by the Neurospora experiments performed ...

Information in DNA - ️️same as mRNA, transcription termination and initiation information, splicing information catalytic domain - ️️protein domain in enzyme-linked receptors, activated by a conformational change induced by the ligand-binding domain, inhibits host cell protein synthesis and interacts with substrate to cause enzyme reaction tRNA - ️️An RNA molecule that functions as an interpreter between nucleic acid and protein language by picking up specific amino acids and r...

USABO Open Exam 2024 | 100%Correct Answers Verified Latest 2024 Version. 1. Why is myelin important in the nervous system? A. It allows signals to travel faster along axons because depolarization occurs only at myelinated locations. B. It allows signals to travel faster along axons because depolarization occurs only at nonmyelinated locations. C. It bundles the dendrites of adjacent neurons together. D. It increases capacitance across the cell membrane, which helps electrical signals to le...

What would be the effect of an antibiotic that bound to the ribosome in the manner of a Class I release factor but prevented RRF binding? a. Prevent ribosome recycling, thus reducing overall protein synthesis b. Cause translation run-through, so that most proteins contained many extra amino acids and were thus non-functional c. Inhibit chain elongation, so that most proteins are truncated and thus non-functional d. Inhibit small subunit recognition of mRNA sequences, reducing overall prote...

Test Bank Porth Pathophysiology Concepts of Altered Health States 2nd Canadian Edition Table of Contents Chapter 01: Concepts of Health and Disease ................................................................................................. 3 Chapter 02: Concepts of Altered Health in Children ................................................................................... 14 Chapter 03: Concepts of Altered Health in Older Adults .............................................................

______ greatly activates the classical pathway of complement activation - IgM _______ is expressed by T cells whose function is to activate other cells. - CD4 ___________ is expressed by cytotoxic T cells - CD8 ____________ molecules present peptides from pathogens, commonly viruses, to CD8 T cells, which are specialized to kill any cell that they specifically recognize. - MHC class I _____________ increases the expression of both MHC Class I and MHC Class II molecules, and can induce the ...