Rna splicing - Guides d'étude, Notes de cours & Résumés

Vous recherchez les meilleurs guides d'étude, notes d'étude et résumés sur Rna splicing ? Sur cette page, vous trouverez 947 documents pour vous aider à réviser pour Rna splicing.

Page 2 sur 947 résultats

Trier par

Bi 112 Ch 15 Questions (2nd Batch) Questions and Answers Already Passed
  • Bi 112 Ch 15 Questions (2nd Batch) Questions and Answers Already Passed

  • Examen • 14 pages • 2024
  • Bi 112 Ch 15 Questions (2nd Batch) Questions and Answers Already Passed What is the role of DNA polymerase in DNA replication? DNA polymerase adds nucleotides to the growing DNA strand and proofreads for errors during replication. How does the structure of DNA contribute to its function? The double helix structure of DNA allows for easy replication and storage of genetic information in a stable form. What is a mutation, and how can it affect an organism? A mutation is a change i...
    (0)
  • €9,77
  • + en savoir plus
TEST BANK for Fundamentals of Molecular Virology 2nd Edition by Acheson
  • TEST BANK for Fundamentals of Molecular Virology 2nd Edition by Acheson

  • Examen • 256 pages • 2023
  • TEST BANK for Fundamentals of Molecular Virology 2nd Edition by Acheson. Package Title: Testbank Course Title: Acheson 2nd edition Chapter Number: 01 Question type: Multiple Choice 1) Which of the following terms describes the protein shell that surrounds the viral genome? a) capsid b) envelope c) matrix d) virion e) capsomere Answer: a 2) Which of the following would not be a nucleic acid form found in a viral genome? a) dsDNA b) ssDNA c) dsRNA d) ssRNA e) an RNA:DN...
    (2)
  • €11,73
  • 2x vendu
  • + en savoir plus
Campbell Biology Chapter 17 Test Questions with Answers
  • Campbell Biology Chapter 17 Test Questions with Answers

  • Examen • 5 pages • 2024
  • Campbell Biology Chapter 17 Test Questions with Answers alternative RNA splicing - Answer-A type of eukaryotic gene regulation at the RNA-processing level in which different mRNA molecules are produced from the same primary transcript, depending on which RNA segments are treated as exons and which as introns Beadle and Tatum - Answer-Exposed bread mold to X-rays, creating mutants. Showed that each gene encodes a particular substance ("one gene, one enzyme" concept, later restated "one gen...
    (0)
  • €12,51
  • + en savoir plus
Essential Cell Biology Exam 1 Questions with Complete Solutions
  • Essential Cell Biology Exam 1 Questions with Complete Solutions

  • Examen • 16 pages • 2024
  • alternative splicing - ANSWER-Splicing of RNA transcripts from the same gene in different ways, each of which produces a distinct protein. aminoacyl-tRNA synthetase - ANSWER-Enzyme that attaches the correct amino acid to a tRNA molecule to form an aminoacyl-tRNA. anticodon - ANSWER-Sequence of three nucleotides in a transfer RNA molecule that is complementary to the three-nucleotide codon on a messenger RNA molecule; each anticodon is matched to a specific amino acid covalently attached el...
    (0)
  • €14,17
  • + en savoir plus
Bio 115 Final Exam- WVU Questions and  Answers Already Passed
  • Bio 115 Final Exam- WVU Questions and Answers Already Passed

  • Examen • 11 pages • 2024
  • Bio 115 Final Exam- WVU Questions and Answers Already Passed How can one eukaryotic gene lead to one transcript, but multiple different proteins? Alternative splicing What is the primary transcript of eukaryotic genes? mRNA What is the attachment site for RNA polymerase? Promoter region Gene regulation in both prokaryotes and eukaryotes is achieved by controlling which process? transcription A eukaryotic gene has all of the following except: introns, a promoter, an operator, ...
    (0)
  • €9,77
  • + en savoir plus
exam 3 genetics 2024/2025 with 100% correct answers
  • exam 3 genetics 2024/2025 with 100% correct answers

  • Examen • 20 pages • 2024
  • Based on what we learned about the most important splicing consensus sequences, what will the sequence of this simplified intron-containing mRNA (written from 5' to 3', left to right) be after splicing occurs? (Don't write anything besides nucleotide letters.) CAAGGUCCCUCCCACCUAGCAA correct answersCAAGCAA, caagcaa, Caagcaa, CaagCaa Which of the following Before/After statements best describes the change in scientific knowledge brought about by the Neurospora experiments performed ...
    (0)
  • €17,11
  • + en savoir plus
Bs161 final 2024 Exam Questions With Answers
  • Bs161 final 2024 Exam Questions With Answers

  • Examen • 18 pages • 2024
  • Bs161 final 2024 Exam Questions With Answers In messenger RNA, the protein-coding sequence is present in: Question options: exons. introns. exons and the poly(A) sequence. introns and the poly(A) sequence. - ANSWER exons. Which process produces multiple proteins from the same primary transcript in the same cell? Question options: chromatin remodeling histone modification alternative splicing combinatorial control - ANSWER alternative splicing Alternative splicing allow...
    (0)
  • €10,55
  • + en savoir plus
USABO Open Exam 2024 | 100%Correct Answers Verified Latest 2024 Version.
  • USABO Open Exam 2024 | 100%Correct Answers Verified Latest 2024 Version.

  • Examen • 17 pages • 2024
  • USABO Open Exam 2024 | 100%Correct Answers Verified Latest 2024 Version. 1. Why is myelin important in the nervous system? A. It allows signals to travel faster along axons because depolarization occurs only at myelinated locations. B. It allows signals to travel faster along axons because depolarization occurs only at nonmyelinated locations. C. It bundles the dendrites of adjacent neurons together. D. It increases capacitance across the cell membrane, which helps electrical signals to le...
    (0)
  • €12,71
  • + en savoir plus
bio 203 final exam Questions & Answers(SCORED A+)
  • bio 203 final exam Questions & Answers(SCORED A+)

  • Examen • 10 pages • 2024
  • RNA polymerase - ANSWER pries the two strands of DNA apart and joins the RNA nucleotides as they base-pair along the DNA templates promoter - ANSWER DNA sequence where RNA polymerase attaches and initiates transcription Synthesis of RNA transcript - ANSWER initiation; elongation; termination synthesis of RNA transcript initiation - ANSWER after RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point of the template stra...
    (0)
  • €11,73
  • + en savoir plus
AAB Molecular Diagnostics questions and answers(latest update)
  • AAB Molecular Diagnostics questions and answers(latest update)

  • Examen • 77 pages • 2024
  • Nucleic Acid grows by attachment of 5' phosphate group of the incoming nucleotide to the 3'hydroxyl group of the last nucleotide double stranded DNA most energetically favorable state for DNA Purines double-ring structure Adenine (A) + Guanine (G) Pyrimidine single-ring structure Uracil (U)+ Cytosine Messenger RNA (mRNA) -template for all protein synthesis -encode all information necessary to produce proteins Heterogeneous nuclear RNA primary product o...
    (0)
  • €14,17
  • + en savoir plus