Rna splicing - Guides d'étude, Notes de cours & Résumés
Vous recherchez les meilleurs guides d'étude, notes d'étude et résumés sur Rna splicing ? Sur cette page, vous trouverez 947 documents pour vous aider à réviser pour Rna splicing.
Page 2 sur 947 résultats
Trier par
-
Bi 112 Ch 15 Questions (2nd Batch) Questions and Answers Already Passed
- Examen • 14 pages • 2024
-
Disponible en pack
-
- €9,77
- + en savoir plus
Bi 112 Ch 15 Questions (2nd Batch) 
Questions and Answers Already Passed 
 
What is the role of DNA polymerase in DNA replication? 
DNA polymerase adds nucleotides to the growing DNA strand and proofreads for errors 
during replication. 
 
How does the structure of DNA contribute to its function? 
 
The double helix structure of DNA allows for easy replication and storage of genetic 
information in a stable form. 
 
What is a mutation, and how can it affect an organism? 
A mutation is a change i...
-
TEST BANK for Fundamentals of Molecular Virology 2nd Edition by Acheson
- Examen • 256 pages • 2023
-
- €11,73
- 2x vendu
- + en savoir plus
TEST BANK for Fundamentals of Molecular Virology 2nd Edition by Acheson. 
Package Title: Testbank 
Course Title: Acheson 2nd edition Chapter Number: 01 
 
 
Question type: Multiple Choice 
 
 
1)	Which of the following terms describes the protein shell that surrounds the viral genome? 
 
a)	capsid 
b)	envelope 
c)	matrix 
d)	virion 
e)	capsomere Answer: a 
 
2)	Which of the following would not be a nucleic acid form found in a viral genome? 
 
a)	dsDNA 
b)	ssDNA 
c)	dsRNA 
d)	ssRNA 
e)	an RNA:DN...
-
Campbell Biology Chapter 17 Test Questions with Answers
- Examen • 5 pages • 2024
-
Disponible en pack
-
- €12,51
- + en savoir plus
Campbell Biology Chapter 17 Test Questions with Answers 
alternative RNA splicing - Answer-A type of eukaryotic gene regulation at the RNA-processing level in which different mRNA molecules are produced from the same primary transcript, depending on which RNA segments are treated as exons and which as introns 
 
Beadle and Tatum - Answer-Exposed bread mold to X-rays, creating mutants. Showed that each gene encodes a particular substance ("one gene, one enzyme" concept, later restated "one gen...
-
Essential Cell Biology Exam 1 Questions with Complete Solutions
- Examen • 16 pages • 2024
-
Disponible en pack
-
- €14,17
- + en savoir plus
alternative splicing - ANSWER-Splicing of RNA transcripts from the same gene in different ways, each of which produces a distinct protein. 
 
aminoacyl-tRNA synthetase - ANSWER-Enzyme that attaches the correct amino acid to a tRNA molecule to form an aminoacyl-tRNA. 
 
anticodon - ANSWER-Sequence of three nucleotides in a transfer RNA molecule that is complementary to the three-nucleotide codon on a messenger RNA molecule; each anticodon is matched to a specific amino acid covalently attached el...
-
Bio 115 Final Exam- WVU Questions and Answers Already Passed
- Examen • 11 pages • 2024
-
Disponible en pack
-
- €9,77
- + en savoir plus
Bio 115 Final Exam- WVU Questions and 
 
Answers Already Passed 
 
How can one eukaryotic gene lead to one transcript, but multiple different proteins? 
Alternative splicing 
 
What is the primary transcript of eukaryotic genes? mRNA 
 
What is the attachment site for RNA polymerase? Promoter region 
 
Gene regulation in both prokaryotes and eukaryotes is achieved by controlling which process? 
transcription 
 
A eukaryotic gene has all of the following except: introns, a promoter, an operator, ...
Être payé chaque semaine ? Vous pouvez!
-
exam 3 genetics 2024/2025 with 100% correct answers
- Examen • 20 pages • 2024
-
- €17,11
- + en savoir plus
Based on what we learned about the most important splicing consensus sequences, what will the sequence of this simplified intron-containing mRNA (written from 5' to 3', left to right) be after splicing occurs? (Don't write anything besides nucleotide letters.) 
 
CAAGGUCCCUCCCACCUAGCAA correct answersCAAGCAA, caagcaa, Caagcaa, CaagCaa 
 
Which of the following Before/After statements best describes the change in scientific knowledge brought about by the Neurospora experiments performed ...
-
Bs161 final 2024 Exam Questions With Answers
- Examen • 18 pages • 2024
-
- €10,55
- + en savoir plus
Bs161 final 2024 Exam Questions With Answers 
 
In messenger RNA, the protein-coding sequence is present in: 
Question options: 
exons. 
introns. 
exons and the poly(A) sequence. 
introns and the poly(A) sequence. - ANSWER exons. 
 
Which process produces multiple proteins from the same primary transcript in the same cell? 
Question options: 
chromatin remodeling 
histone modification 
alternative splicing 
combinatorial control - ANSWER alternative splicing 
 
Alternative splicing allow...
-
USABO Open Exam 2024 | 100%Correct Answers Verified Latest 2024 Version.
- Examen • 17 pages • 2024
-
Disponible en pack
-
- €12,71
- + en savoir plus
USABO Open Exam 2024 | 100%Correct Answers Verified Latest 2024 Version. 
1. Why is myelin important in the nervous system? 
A. It allows signals to travel faster along axons because depolarization occurs only at myelinated 
locations. 
B. It allows signals to travel faster along axons because depolarization occurs only at nonmyelinated locations. 
C. It bundles the dendrites of adjacent neurons together. 
D. It increases capacitance across the cell membrane, which helps electrical signals to le...
-
bio 203 final exam Questions & Answers(SCORED A+)
- Examen • 10 pages • 2024
-
Disponible en pack
-
- €11,73
- + en savoir plus
RNA polymerase - ANSWER pries the two strands of DNA apart and joins the RNA nucleotides as they base-pair along the DNA templates 
 
promoter - ANSWER DNA sequence where RNA polymerase attaches and initiates transcription 
 
Synthesis of RNA transcript - ANSWER initiation; elongation; termination 
 
synthesis of RNA transcript initiation - ANSWER after RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point of the template stra...
-
AAB Molecular Diagnostics questions and answers(latest update)
- Examen • 77 pages • 2024
-
- €14,17
- + en savoir plus
Nucleic Acid 
grows by attachment of 5' phosphate group of the incoming nucleotide to the 3'hydroxyl group of the last nucleotide 
 
 
 
double stranded DNA 
most energetically favorable state for DNA 
 
 
 
Purines 
double-ring structure Adenine (A) + Guanine (G) 
 
 
 
Pyrimidine 
single-ring structure Uracil (U)+ Cytosine 
 
 
 
Messenger RNA (mRNA) 
-template for all protein synthesis 
-encode all information necessary to produce proteins 
 
 
 
Heterogeneous nuclear RNA 
primary product o...
Ce résumé que vous venez d'acheter a fait très plaisir à quelqu'un. Vous voulez aussi être payé chaque semaine ? Vendez vos documents d'étude sur Stuvia ! Découvrez tout sur gagner de l'argent sur Stuvia