Formamide Samenvattingen, Notities en Examens

What is metagenome? - correct answer Sampling the genome sequence of a community of organisms. Polymorphism involved for Irinotecan? - correct answer UGT1A1 NGS related to deletions and insertions, coverage, depth? - correct answer -Paired-end reads for detection of indels -Coverage is how much of your target has been read -Depth is how many times a...

What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% 92.5 % Multiply all PI together =...

Pyrimidine - Answer One carbon ring Cytosine, Thymine, Uracil Purine - Answer Two carbon rings Adenine, Guanine How are nucleotides joined together? - Answer Condensation to form phosphodiester bond What is the function of mRNA? - Answer Carries genetic info out of nucleus Transcript translated to protein What is the function of tRNA? - Answer Carries aa to ribosome Anticodon pairs with codon on mRNA strand What is the function of rRNA? - Answer part of ribosome structure most abundan...

Technologist in Molecular Biology, MB(ASCP) board exam prep 2024 with 100% Correct Answers Pyrimidine - Answer ️️ -One carbon ring Cytosine, Thymine, Uracil What is the function of mRNA? - Answer ️️ -Carries genetic info out of nucleus Transcript translated to protein What is the function of tRNA? - Answer ️️ -Carries aa to ribosome Anticodon pairs with codon on mRNA strand What is the function of rRNA? - Answer ️️ -part of ribosome structure most abundant RNA coordina...

ASCP MB MB Questions and Answers 100% correct B form DNA Right handed, 10.5 bp Lysine (K) and Arginine (R) Associated with Histones Bromophenol blue Tracking dye Capillary electrophoresis Must be ss PFGE buffer TBE Store RNA > 7 months -70 ethanol Branched DNA DNA/RNA targets Methylation or FISH PWS/AG Nested PCR 2nd step, more specific Denaturation HPLC Detecting polymorphisms MRSA mecA gene mecA Penici...

MB ASCP Demo Practice Exam Questions with complete solutions 1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' A. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D....

ASCP Technologist in Molecular Biology board exam prep with complete solution 2023/2024 Pyrimidine One carbon ring Cytosine, Thymine, Uracil Purine Two carbon rings Adenine, Guanine How are nucleotides joined together? Condensation to form phosphodiester bond What is the function of mRNA? Carries genetic info out of nucleus Transcript translated to protein What is the function of tRNA? Carries aa to ribosome Anticodon pairs with codon on mRNA strand What is the function of rRNA?...

(MB) ASCP Exam What kind of bond do histones have with DNA? - Answer Ionic What amino acids compose histones? - Answer Lysine and Arginine Which lymphoma has t-cell rearrangements? - Answer Sezary Syndrome Acute Promyelocytic leukemia translocation? - Answer t(15,17) Leading strand polymerase: - Answer Delta DNA repair polymerase(s): - Answer Beta or Epsilon Mitochondrial polymerase: - Answer Gamma Molecular beacon design: - Answer (R-sequence-Q) Which method uses v...

ASCP Technologist in Molecular Biology board exam prep with complete solution 2023/2024 Pyrimidine One carbon ring Cytosine, Thymine, Uracil Purine Two carbon rings Adenine, Guanine How are nucleotides joined together? Condensation to form phosphodiester bond What is the function of mRNA? Carries genetic info out of nucleus Transcript translated to protein What is the function of tRNA? Carries aa to ribosome Anticodon pairs with codon on mRNA strand What is the function of rRNA?...

What kind of bond do histones have with DNA? - Answer Ionic What amino acids compose histones? - Answer Lysine and Arginine Which lymphoma has t-cell rearrangements? - Answer Sezary Syndrome Acute Promyelocytic leukemia translocation? - Answer t(15,17) Leading strand polymerase: - Answer Delta DNA repair polymerase(s): - Answer Beta or Epsilon Mitochondrial polymerase: - Answer Gamma Molecular beacon design: - Answer (R-sequence-Q) Which method uses visible light? - Answer Pyrosequencing Lagging...