BSC 219 Final (All Correctly Answered)

You discover a new bacterial operon that is induced by the presence of lead. You find a mutation that results in a mutation in the operator that changes the binding sequence so that the repressor is always bound to it. Would this mutation be rescued by a plasmid with a wild type copy of the operon and why? correct answers Yes, because the repressor would still be able to bind to the operator in the plasmid allowing for normal expression from the plasmid Why is it difficult to find a treatment for Alzheimer's disease? correct answers Once APP is cleaved, this is not reversible, leading to the accumulation and aggregation of A-beta What would happen if the following sequence was mutated? 5'GGUCAUGG3' correct answers The open reading frame wouldn't be set Which of the following sequence translates as LEAVES? correct answers CUAAAACACUUGGAAGCCGUAGAGAGUGUCCCA What would be the peptide made if the genetic code was overlapping? 5' ACAGCAGUAUGG 3' correct answers thr-gln-ser-ala-gln-ser-val-tyr-met-trp You find that the presence of the antibiotic penicillin prevents the expression of the Detox operon in bacteria. What kind of operon is this and why? correct answers . It is repressible because penicillin turns off the operon You find a mutation that causes the trp operon to be transcribed but never translated. Which of the following is a possible reason for this phenotype? correct answers There is a mutation in region 3 that prevents the 2-3 hairpin to form You discover a cancerous lung cell in one of your patients. You find that there is a problem with splicing so that all the introns are still present in all mRNAs. What might be a reason for this phenotype? correct answers U2 doesn't move the branch point to the 5' end of the intron Which of the following is true about polycistronic genes? correct answers Polycistronic genes are all transcribed from a single promotor What would happen if IF-1 was mutated? correct answers A tRNA would be able to enter the A site prematurely The open reading frame may not be set None of these The large ribosome would still bind to the small ribosome Translate the sequence below. 5' CCUCAGCAAUGAUUCAGGUCACUUAUUCAGUCUACAACGGUCAACCGAGGCACACUGA 3' correct answers MIQSTTAH