Isomerase - Study guides, Class notes & Summaries

Enzymes correct answer: Proteins that act as catalyst for biochemical reactions Are enzymes consumed in a reaction? correct answer: Not consumed during the reaction Majority of enzymes are correct answer: Globular proteins Enzyme activity is affected by correct answer: pH, Temperature, or concentration What do enzyme co factors do? correct answer: Provide additional chemically reactive functional groups What are the categories of co factor enzymes correct answer: Simple meta...

Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particul...

Where in the cell does the PPP occur? - Cytosol The metabolic function of the pentose phosphate pathway is to: - generate NADPH and pentoses for reduction and biosynthesis reactions. f a liver cell converts glucose to ribulose 5 phosphate, and then converts that ribulose 5 phosphate to fructose 6 phosphate and glyceraldehyde 3 phosphate for use in glycolysis, which of the following statements must be True? - The cell needs NADPH and ATP. Susceptibility to oxidative damage to red blood cell...

Chem 210 Module 7 Exam Review Questions With Answers Latest 2023/2024 (Verified) In glycolysis, when glucose enters a cell, it is immediately phosphorylated to form glucose-6-phosphate. The phosphate donor in this reaction is ATP, and the enzyme is ________. Hexokinase Aldolase CoA Phosphohexose isomerase None of the above HEXOKINASE Question 10 3 / 3 pts In the last reaction of glycolysis, ATP is formed by the direct transfer of a phosphate group from a metabolite to ADP. This...

a-D-glucose + ATP ---> ________ + ________ + H+ correct answer: a-D-glucose-6-phosphate + ADP For the first five steps of glycolysis, the appropriate sequence of enzymes is: a. phosphofructokinase-1 (PFK-1) b. hexokinase/glucokinase c. fructose bisphosphate aldolase d. phosphoglucoisomerase e. triose phosphate isomerase (TPI) correct answer: B, D, A, C, E Hexokinase and glucokinase belong to the kinase subclass of what class of enzymes? correct answer: transferase In the ...

Biology 3221A Biochemistry Final Exam Q&A- Rush University Which of the following single-base DNA gene coding changes is least likely to significantly affect the function of resulting protein? (Harper pages 361-363) A. Missence mutation resulting to histidine-to-glutamic acid change B. Silent mutations in the third codon base C. Frameshift mutation D. Nonsense mutation 2. Which of the following is a property of enhancer elements? (Harper pages 384-385) A. They do not work located downs...

Portage Learning CHEM 210 exams 1-8 and final exam Question 1 3 / 3 pts True or False: According to the Module, a compound with a molecular mass of 1,000 g/mol is considered a macromolecule. True Correct! False Question 2 3 / 3 pts True or False: Biomolecules can have only two functional groups. True Correct! False Question 3 3 / 3 pts True or False: The following functional group is an alcohol. True Correct! False Question 4 3 / 3 pts True or False: In ...

BIOL2400 Final Exam Practice Questions With Answers Latest 2023/2024. SNP data (the third codon position of a nuclear gene) from 1000 individuals on the enzyme Phosphoglucose isomerase (PGI) was collected from two populations of perch in two local rivers and also from Guelph Lake. As is usual for a SNP only two alleles were found: A1=C and A2=G. The genotype data for each population is given in the Table 1 below: Table 1: Perch genotypes: CC CG GG p(C) q(G) Eramosa R. .4 0.6 Speed R. ....

The oocytes used in the research study were taken from newborns. The oocytes used in the research study in the passage were: A. haploid cells arrested in prophase I. B. diploid cells arrested in prophase I. C. diploid cells arrested in metaphase I. D. haploid cells arrested in anaphase II. - ANS B. The cells would be in the period of arrest between the onset of oogenesis in the fetal stage and the onset of the menstrual cycle, when one cell per month will move forward with meiosis...

If the G'° of the reaction A -> B is -40 kJ/mol, under standard conditions the reaction: A) is at equilibrium. B) will never reach equilibrium. C) will not occur spontaneously. D) will proceed at a rapid rate. E) will proceed spontaneously from left to right. - E) will proceed spontaneously from left to right. For the reaction A - B,G'° = -60 kJ/mol. The reaction is started with 10 mmol of A; no B is initially present. After 24 hours, analysis reveals the presence of 2 mmol o...