Isomerase - Study guides, Class notes & Summaries

Biology 3221A Biochemistry Final Exam Q&A- Rush University Which of the following single-base DNA gene coding changes is least likely to significantly affect the function of resulting protein? (Harper pages 361-363) A. Missence mutation resulting to histidine-to-glutamic acid change B. Silent mutations in the third codon base C. Frameshift mutation D. Nonsense mutation 2. Which of the following is a property of enhancer elements? (Harper pages 384-385) A. They do not work located downs...

Chem 210 Module 7 Exam Review Questions With Answers Latest 2023/2024 (Verified) In glycolysis, when glucose enters a cell, it is immediately phosphorylated to form glucose-6-phosphate. The phosphate donor in this reaction is ATP, and the enzyme is ________. Hexokinase Aldolase CoA Phosphohexose isomerase None of the above HEXOKINASE Question 10 3 / 3 pts In the last reaction of glycolysis, ATP is formed by the direct transfer of a phosphate group from a metabolite to ADP. This...

BIOL2400 Final Exam Practice Questions With Answers Latest 2023/2024. SNP data (the third codon position of a nuclear gene) from 1000 individuals on the enzyme Phosphoglucose isomerase (PGI) was collected from two populations of perch in two local rivers and also from Guelph Lake. As is usual for a SNP only two alleles were found: A1=C and A2=G. The genotype data for each population is given in the Table 1 below: Table 1: Perch genotypes: CC CG GG p(C) q(G) Eramosa R. .4 0.6 Speed R. ....

BIO 441A EXAM 3 STUDY GUIDE WITH COMPLETE SOLUTION. LECTURE ONE - METABOLISM INTRODUCTION ● Autotrophs synthesize all their own cellular constituents from simple molecules ● Heterotrophs obtain energy through oxidation of organic compounds and therefore rely on autotrophs ● Metabolism involves many reactions such as ○ Glycolysis/gluconeogenesis ○ The citric acid cycle ○ Oxidative phosphorylation ● Catabolism is the degradation of biomolecules ○ Energy rich nutrients are...

Where in the cell does the PPP occur? - Cytosol The metabolic function of the pentose phosphate pathway is to: - generate NADPH and pentoses for reduction and biosynthesis reactions. f a liver cell converts glucose to ribulose 5 phosphate, and then converts that ribulose 5 phosphate to fructose 6 phosphate and glyceraldehyde 3 phosphate for use in glycolysis, which of the following statements must be True? - The cell needs NADPH and ATP. Susceptibility to oxidative damage to red blood cell...

Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particul...

a basic amino acid has an R group that contains - an amine group a competitive inhibitor is one that - binds to the active site in place of the substrate a lipid formed by esterification of 3 fatty acids to a glycerol is commonly named? - triglyceride a noncompetitive inhibitor has a structure that - does not resemble the substrate structure a polyunsaturated fatty acid contains more than one - double bond a triacylglycerol that is solid at room temp is called an - fat Active site of an en...

what percentage of water is in the body? 60% Relationship between protons and acids & bases Acids donate proton. Bases accept proton Strong Acids Vs Weak Acids Strong acids fully dissociate (100%) and weak acids partially dissociate properties of water dipole dipole polar H bonding dissolves electrolytes ( CL /Na) Small Kd- doesn't dissociate alot kw ion product 10^-14 pH -log[H+] biological PH 7.4 types of buffers phosphates, bicarbo...

Environmental Regulation - correct answer Changing the temperature or PH will alter the activity of an enzyme. Temporal Regulation - correct answer Enzymes are made or destroyed when a cell needs or doesn't The energy currency used by cells is ____________. - correct answer ATP A reducing chemical reaction _______. - correct answer adds an electron to the substrate. Chemiosmosis - correct answer Process in which there is a production of ATP in cellular metabolism by the involvement of a pr...

Portage Learning CHEM 210 exams 1-8 and final exam Question 1 3 / 3 pts True or False: According to the Module, a compound with a molecular mass of 1,000 g/mol is considered a macromolecule. True Correct! False Question 2 3 / 3 pts True or False: Biomolecules can have only two functional groups. True Correct! False Question 3 3 / 3 pts True or False: The following functional group is an alcohol. True Correct! False Question 4 3 / 3 pts True or False: In ...