100% tevredenheidsgarantie Direct beschikbaar na betaling Zowel online als in PDF Je zit nergens aan vast
logo-home
Eerder door jou gezocht
Eerder door jou gezocht
logo
ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE €10,71   In winkelwagen
Snel navigeren naar
Voorbeeld
  2.  
  3. ASCP
  4.  
  5. ASCP

Tentamen (uitwerkingen)

ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE

2 beoordelingen
 12 keer bekeken  0 keer verkocht
  • Vak
  • ASCP
  • Instelling
  • ASCP

ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE

Voorbeeld 3 van de 28  pagina's

Document informatie

  • 15 mei 2024
  • 28
  • 2023/2024
  • Tentamen (uitwerkingen)
  • Vragen en antwoorden

Onderwerpen

  • ascp practice exam questions latest updated
  • ascp practice exam questions
  • ascp practice exam questions and answers
  • ascp practice exam graded a
  • ascp practice exam questions expert verified

Geschreven voor

  • ASCP
  • ASCP

2  beoordelingen

review-writer-avatar

Door: RegisteredNurse • 3 maanden geleden

It is detailed, quality information and I passed

review-writer-avatar

Door: RegisteredNurse • 6 maanden geleden

The content provided is top-notch and worth every penny. I highly recommend.

Verkoper

avatar-seller
DrBellaPhD

Ontvangen beoordelingen

Voorbeeld van de inhoud

ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE Mutation in what gene is associated with Fragile X syndrome? FMR1 Mantle cell lymphoma (MCL) is caused by what translocation? t(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments Okazaki fragments What gene is mea sured following treatment with imatinib (Gleevec)? FLT3 BCR/Abl Jak2 MAPK BCR/Abl What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second 50 nucleotides per se cond This polymerase is involved in "replicates mitochondrial DNA": Pol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow -up visit. The physician suspects a single -
gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation -specific PCR Standard PCR PFGE RAPD PCR Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22-25ºC 2-8ºC -20ºC -70ºC -70ºC Consider a hypothetical mutation involving gene X. Let's say you a mplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp m/+ = 350 bp; 250 bp; 100 bp Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 7 5°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer Increase the concentration of salt in the wash solution buffer What enzyme is involved in LCR? DNA Ligase Next Generation Sequencing set -up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors Hybridization Library preparation and extensive bioinformatics analysis Which of the subunits of RNA polym erase holoenzyme is responsible for promoter recognition? Beta subunit Sigma subunit Gamma subunit Delta subunit Sigma subunit While at the doctor's office with your father, you overheard his physician tell another physician that test results came in, conf irming the presence of the Factor V Leiden mutation, a mutation associated with deep venous thrombosis. Which of the following is the mutation your father has: A1691G G1619A 1691G>A C282Y 1691G>A Consider the probe sequence, CTACCGTAATATTCGACCGT, to be use d in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C 58°C This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta -globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a

Voordelen van het kopen van samenvattingen bij Stuvia op een rij:

Verzekerd van kwaliteit door reviews

Verzekerd van kwaliteit door reviews

Stuvia-klanten hebben meer dan 700.000 samenvattingen beoordeeld. Zo weet je zeker dat je de beste documenten koopt!

Snel en makkelijk kopen

Snel en makkelijk kopen

Je betaalt supersnel en eenmalig met iDeal, creditcard of Stuvia-tegoed voor de samenvatting. Zonder lidmaatschap.

Focus op de essentie

Focus op de essentie

Samenvattingen worden geschreven voor en door anderen. Daarom zijn de samenvattingen altijd betrouwbaar en actueel. Zo kom je snel tot de kern!

Veelgestelde vragen

Wat krijg ik als ik dit document koop?

Je krijgt een PDF, die direct beschikbaar is na je aankoop. Het gekochte document is altijd, overal en oneindig toegankelijk via je profiel.

Tevredenheidsgarantie: hoe werkt dat?

Onze tevredenheidsgarantie zorgt ervoor dat je altijd een studiedocument vindt dat goed bij je past. Je vult een formulier in en onze klantenservice regelt de rest.

Van wie koop ik deze samenvatting?

Stuvia is een marktplaats, je koop dit document dus niet van ons, maar van verkoper DrBellaPhD. Stuvia faciliteert de betaling aan de verkoper.

Zit ik meteen vast aan een abonnement?

Nee, je koopt alleen deze samenvatting voor €10,71. Je zit daarna nergens aan vast.

Is Stuvia te vertrouwen?

4,6 sterren op Google & Trustpilot (+1000 reviews)

Afgelopen 30 dagen zijn er 64438 samenvattingen verkocht

Opgericht in 2010, al 14 jaar dé plek om samenvattingen te kopen

Start met verkopen
€10,71
  • (2)
  Kopen