Bch3703 - Study guides, Study notes & Summaries

Looking for the best study guides, study notes and summaries about Bch3703? On this page you'll find 3 study documents about Bch3703.

All 3 results

Sort by

Past 10 yrs BCH3702 EXAM QUESTIONS WITH MEMO - 100% PASS
  • Past 10 yrs BCH3702 EXAM QUESTIONS WITH MEMO - 100% PASS

  • Exam (elaborations) • 68 pages • 2023
  • these documents provide the guide to past exams with detailed answers.
    (0)
  • R90,00
  • 2x sold
  • + learn more
Department of Life and Consumer Sciences Molecular Genetics
  • Department of Life and Consumer Sciences Molecular Genetics

  • Exam (elaborations) • 5 pages • 2022
  • Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particul...
    (1)
  • R223,45
  • 1x sold
  • + learn more
The best study material for Biochemistry and Microbiology modules. Answers to assignment questions and memos to help you get ready for exams.
  • The best study material for Biochemistry and Microbiology modules. Answers to assignment questions and memos to help you get ready for exams.

  • Exam (elaborations) • 2 pages • 2022
  • The best study material for Biochemistry and Microbiology modules. Answers to assignment questions and memos to help you get ready for exams.
    (0)
  • R305,00
  • + learn more